Volume 9 - Number 3-4 - September 2014
Multidisciplinary
Respiratory Medicine
Official Journal of
– Interdisciplinary Association for Research in Lung Disease
Editors-in-Chief
F. De Benedetto
C.F. Donner
C.M. Sanguinetti
d
Mel
b
u
In PCentra 8
5
F 0. IF
I
.
UN PUS
SCO0.664
P.M.A. Calverley
Integrating COPD care in Italy
G. Bettoncelli, F. Blasi, V. Brusasco, S. Centanni, A. Corrado, F. De Benedetto, F. De Michele, G.U. Di Maria, C.F Donner, F. Falcone, C. Mereu,
S. Nardini, F. Pasqua, M. Polverino, A. Rossi, C.M. Sanguinetti
The clinical and integrated management of COPD. An official document of AIMAR (Interdisciplinary Association
for Research in Lung Disease), AIPO (Italian Association of Hospital Pulmonologists), SIMER (Italian Society
of Respiratory Medicine), SIMG (Italian Society of General Medicine)
R. Asciak, M. Balzan, J. Buttigieg
Predictors of seasonal influenza vaccination in chronic asthma
B. Ozyurek, S. Ulasli, S. Bozbas, N. Bayraktar, S. Akcay
Value of serum and induced sputum surfactant protein-D in chronic obstructive pulmonary disease
F. Karimi-Busheri, A. Rasouli-Nia, V. Zadorozhny, H. Fakhrai
CD24+/CD38- as new prognostic marker for non-small cell lung cancer
C.M. Sanguinetti
The lungs need to be deflated: effects of glycopyrronium on lung hyperinflation in COPD patients
G. Liccardi, M. Bilò, C. Mauro, A. Salzillo, A. Piccolo, M. D’Amato, A. Liccardi, G. D’Amato
Oxytocin: an unexpected risk for cardiologic and broncho-obstructive effects,
and allergic reactions in susceptible delivering women
Abstracted/ Indexed in: PubMed Central, Embase, Journal Citation Reports/Science Edition and SCOPUS
Multidisciplinary Respiratory Medicine
www.mrmjournal.com
AIMS AND SCOPE
Multidisciplinary Respiratory Medicine is a peer-reviewed, open access
journal encompassing all aspects of respiratory medicine. It has a
particular focus on interdisciplinary and translational research. Multidisciplinary Respiratory Medicine is the official journal of the Italian
scientific society AIMAR www.aimarnet.it.
The journal aims to provide a forum for the publication and free
access of high quality original scientific articles, reviews and position
papers documenting clinical and experimental advances in respiratory medicine, and related fields.
Given the journals interdisciplinary character, the target readership
is wider than respiratory medicine, embracing numerous related
disciplines (allergology, immunology, internal medicine, geriatrics,
infectious diseases, intensive care, etc) and health professionals.
COPYRIGHT AND LICENSE AGREEMENT
All articles published on the online version by Multidisciplinary Respiratory Medicine are made freely and permanently accessible online
immediately upon publication, without subscription charges or
registration barriers at http://www.mrmjournal.com. Further information about open access can be found at http://www.biomedcentral.com/about/charter.
Authors of articles published on the online version of the Journal
are the copyright holders of their articles and have granted to any
third party, in advance and in perpetuity, the right to use, reproduce
or disseminate the article, according to the BioMed Central copyright
and license agreement (see http://www.biomedcentral.com/authors/license for more information).
PRODUCTION ONLINE VERSION
BioMed Central
236 Gray’s Inn Road
London WC1X 8HB
United Kingdom
Tel.: +44-(0)20-31922009
e-mail: [email protected] (Editorial enquiries); [email protected] (Technical support and any other enquiries)
PRODUCTION PRINT VERSION AND ADVERTISING
Novamedia Srl
Viale Marazza 30
28021 Borgomanero (No), Italy
Tel.: +39-0322-843222
e-mail: [email protected]
EDITORIAL OFFICE
Lilia Giannini
Via Monsignor Cavigioli 10, 28021 Borgomanero (NO), Italy
Tel.: +39-0322-843222
Fax: +39-0322-843222
e-mail: [email protected]
MANAGING DIRECTOR – DIRETTORE RESPONSABILE
Claudio M. Sanguinetti, Rome, Italy
SUBSCRIPTION INFORMATION
Annual subscription rate for the print version (3 issues plus eventual
supplements) € 90.00.
For AIMAR members subscription to the journal is included in the
membership dues of the Association.
For further information, contact Novamedia srl, tel. +39-0322-843222,
[email protected].
ISSN 1828-695X
INFORMATION TO THE READER
Notification in accordance with art. 13, legislative decree 196/2003.
Subscribers’ information is utilized, also in electronic mode, for the
purpose of journal delivery as required and for related activities.
Data treatment is owned by Novamedia srl, Via Cavigioli 10, 28021
Borgomanero (NO), Italy. The categories of persons responsible for
data treatment for the above purpose are those involved in the
registration, modification, elaboration and printing of data, in the
production and delivery of the journal, in the call centers, and in
the administration and economic management.
As at art.7, legis. decree 196/2003, it is possible to exercise one’s
right to consult, modify, update or cancel one’s information by applying to Novamedia srl, at the above address, who, on request,
will provide a list of the responsible persons.
TYPESETTER
IKONA, Milan, Italy
PRINTER
Centrostampa Srl, Novara, Italy
Registered at the Court of Novara n. 120/05 on 11/11/05.
Distribution in Italy occurs according to the Italian Law 196/2003
OWNERSHIP
Novamedia Srl, Viale Marazza 30, 28021 Borgomanero (NO), Italy
Multidisciplinary
Respiratory Medicine
Official Journal of
– Interdisciplinary Association for Research in Lung Disease
Editors-in-Chief
Fernando De Benedetto SS. Annunziata Hospital, Chieti, Italy
Claudio F Donner Mondo Medico Clinic, Borgomanero, Italy
Claudio M Sanguinetti Quisisana Clinical Center, Rome, Italy
Deputy Editors
Stefano Nardini Vittorio Veneto General Hospital, Vittorio Veneto, Italy
Mario Polverino High Speciality Regional Centre, Salerno, Italy
Editorial Board
•
•
•
•
• Nicolino Ambrosino University Hospital Pisa, Pisa, Italy
• Isabella Annesi-Maesano Institut National de la Santé
et de la Recherche Médicale, Paris, France
• Antonio Anzueto University of Texas, San Antonio, USA
• Peter Barnes Imperial College London, London, UK
• Panagiotis Behrakis Henry Dunant Hospital, Athens, Greece
• Alberto Braghiroli Scientific Institute of Veruno, Veruno, Italy
• Peter Calverley University of Liverpool, Liverpool, UK
• Mauro Carone Scientific Institute of Cassano Murge, Cassano
Murge, Italy
• Richard Casaburi UCLA Medical Center, Los Angeles, USA
• Lucio Casali University of Perugia, Perugia, Italy
• Mario Cazzola University of Rome, Rome, Italy
• Bartolome Celli Brigham and Women’s Hospital, Boston, USA
• Stefano Centanni University of Milan, Milan, Italy
• Alexander A Chuchalin Russian Medical State University,
Moscow, Russian Federation
• George Cremona Scientific Institute San Raffaele, Milan, Italy
• Ronald Dahl Aarhus University Hospital, Aarhus, Denmark
• Roberto W Dal Negro Orlandi Hospital, Bussolengo, Italy
• Filippo De Marinis San Camillo-Forlanini High Specialization
Hospital, Rome, Italy
• Andrew Farmer University of Oxford, Oxford, UK
• Roger Goldstein University of Toronto, Toronto, Canada
• Peter Howard University of Sheffield, Sheffield, UK
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
3
MRM
Francesco Ioli Scientific Institute of Veruno, Veruno, Italy
Günseli Kilinc University of Istanbul, Istanbul, Turkey
Giovanni Paolo Ligia R. Binaghi Hospital, Cagliari, Italy
Marc Miravitlles Pneumology Department, Hospital
Universitary Vall d'Hebron, Barcelona, Spain
Riccardo Pela C. e G. Mazzoni Hospital, Ascoli Piceno, Italy
Stephen I Rennard University of Nebraska, Omaha, USA
Luca Richeldi University of Modena and Reggio Emilia,
Modena, Italy
Josep Roca Institut d’Investigacions Biomèdiques August Pi i
Sunyer, Barcelona, Spain
Yogesh Saini University of North Carolina, Chapel Hill, USA
Gianfranco Sevieri Viareggio, Lucca, Italy
Nikolaos Siafakas University of Crete, Heraklion, Greece
Samy Suissa McGill University, Montreal, Canada
Martin Tobin University of Chicago, Maywood, USA
Philip Tǿnnesen Gentofte University Hospital, Copenhagen,
Denmark
Roberto Torchio S. Luigi Hospital, Orbassano, Italy
Jadwicha Wedzicha University College London, London, UK
Robert West University College, London, UK
Emiel FM Wouters University Hospital Maastricht, Mastricht,
Netherlands
Jan Zielinski University of Warsaw, Warsaw, Poland
Richard Zuwallack University of Connecticut, Hartford, USA
FISAR
Fondazione Italiana Salute Ambiente e Respiro ONLUS, impresa sociale
Campagna 5x1000 anno 201*
Chi siamo
La Fondazione Italiana Salute Ambiente e Respiro (FISAR) nasce nel giugno 2006 per iniziativa di autorevoli esponenti del mondo scientifico nel settore della Medicina Respiratoria. Le sue finalità sono orientate a sviluppare iniziative, sia in campo scientifico, che formativo, che realizzativo di servizi ed attività assistenziali a favore dei
pazienti affetti da patologie dell'apparato respiratorio. Tali finalità potranno essere realizzate anche attraverso iniziative finalizzate alla prevenzione delle patologie respiratorie come degli infortuni sul lavoro e malattie professionali legate a problematiche di tipo respiratorio.
La Fondazione Italiana Salute, Ambiente e Respiro ONLUS si propone nel mondo dell'assistenza al paziente respiratorio come un preciso punto di riferimento, candidandosi a svolgere un ruolo che, all'insegna del perseguimento
dello sviluppo delle conoscenze scientifiche e della qualità ed appropriatezza dei percorsi assistenziali, stabilisca un
ponte solido e duraturo tra il mondo scientifico e le realizzazioni concrete finalizzate alla soddisfazione dei bisogni
di salute.
5 PER MILLE A FISAR ONLUS
Memorizzate questo numero: 02173420692
È il codice fiscale/partita iva della Fondazione FISAR. Di persona o attraverso il proprio commercialista potrete sottoscriverlo nella prossima dichiarazione dei redditi alla voce 5 per mille.
Ci permetterete così di destinare questi fondi alla ricerca sulle malattie polmonari.
Istruzioni per la compilazione della sezione dedicata:
“Sulla base della scelta effettuata dai contribuenti, una quota pari al cinque per mille della loro imposta sul reddito
delle persone fisiche è destinata:
š al sostegno del volontariato e delle altre organizzazioni non lucrative di utilità sociale (ONLUS) di cui all’art. 10
del D. Lgs. 4 dicembre 1997, n. 460, e successive modificazioni, nonché delle associazioni di promozione sociale
iscritte nei registri nazionale, regionali e provinciali previsti dall’art. 7, commi 1, 2, 3 e 4 della legge 7 dicembre
2000, n. 383, e delle associazioni e fondazioni riconosciute che operano nei settori di cui all’art. 10, comma 1
lett. a) del D. Lgs. 4 dicembre 1997, n. 460;
š al finanziamento della ricerca scientifica e dell’università;
š al finanziamento della ricerca sanitaria;
š ad attività sociali svolte dal comune di residenza del contribuente.
Per esprimere la scelta dovete apporre la vostra firma nel riquadro corrispondente ad una soltanto delle quattro
finalità destinatarie della quota del cinque per mille dell’IRPEF. Tale scelta non determina maggiori imposte da
pagare. Grazie per l’attenzione!
INDEX
Editorial
Integrating COPD care in Italy
Peter MA Calverley
7
Position paper
The clinical and integrated management of COPD. An official document of AIMAR (Interdisciplinary
Association for Research in Lung Disease), AIPO (Italian Association of Hospital Pulmonologists),
SIMER (Italian Society of Respiratory Medicine), SIMG (Italian Society of General Medicine)
Germano Bettoncelli, Francesco Blasi, Vito Brusasco, Stefano Centanni, Antonio Corrado,
Fernando De Benedetto, Fausto De Michele, Giuseppe U Di Maria, Claudio F Donner, Franco Falcone,
Carlo Mereu, Stefano Nardini, Franco Pasqua, Mario Polverino, Andrea Rossi, Claudio M Sanguinetti
9
Original research articles
Predictors of seasonal influenza vaccination in chronic asthma
Rachelle Asciak, Martin Balzan, Jesmar Buttigieg
25
Value of serum and induced sputum surfactant protein-D in chronic obstructive pulmonary disease
Berna A Ozyurek, Sevinc S Ulasli, Serife S Bozbas, Nilufer Bayraktar, Sule Akcay
31
Predictive value of troponins and simplified pulmonary embolism severity index in patients
with normotensive pulmonary embolism
Savas Ozsu, Yasin Abul, Asim Orem, Funda Oztuna, Yilmaz Bulbul, Huseyin Yaman, Tevfik Ozlu
39
CD24+/CD38- as new prognostic marker for non-small cell lung cancer
Feridoun Karimi-Busheri, Aghdass Rasouli-Nia, Victoria Zadorozhny, Habib Fakhrai
47
Pulmonary manifestations in Behçet disease: impaired natural killer cells activity
Kamel Hamzaoui, Anissa Berraies, Wajih Kaabachi, Jamel Ammar, Agnès Hamzaoui
57
Reviews
The lungs need to be deflated: effects of glycopyrronium on lung hyperinflation in COPD patients
Claudio M Sanguinetti
Expiratory CT scan in patients with normal inspiratory CT scan: a finding of obliterative bronchiolitis
and other causes of bronchiolar obstruction
Michele Gaeta, Fabio Minutoli, Giuseppe Girbino, Alessandra Murabito, Caterina Benedetto,
Rosario Contiguglia, Paolo Ruggeri, Salvatore Privitera
65
75
Commentary
Oxytocin: an unexpected risk for cardiologic and broncho-obstructive effects, and allergic reactions
in susceptible delivering women
Gennaro Liccardi, Maria Beatrice Bilò, Ciro Mauro, Antonello Salzillo, Amedeo Piccolo, Maria D’Amato,
Annabella Liccardi, Gennaro D’Amato
5
MRM
83
Index
Case reports
Isoniazid- and rifampicin-induced thrombocytopenia
Fatih Yakar, Namşan Yildiz, Aysun Yakar, Zeki Kılıçaslan
Type I Arnold-Chiari malformation with bronchiectasis, respiratory failure,
and sleep disordered breathing: a case report
Raffaele Campisi, Nicola Ciancio, Laura Bivona, Annalisa Di Maria, Giuseppe Di Maria
87
91
Rassegna
Stress ossidativo e infiammazione nella BPCO. Alternative terapeutiche dell'infiammazione cronica
Stefano Marinari, Antonella Spacone, Fernando De Benedetto
I
Rubriche
Notiziario AIMAR
Mario Polverino
XI
Aggiornamento sui progetti AIMAR
Alberto Visconti
XII
Comunicazione
Sindrome delle apnee ostruttive nel sonno e patente di guida:
aggiornamento della normativa comunitaria europea
Antonio Sanna
XIV
L'Angolo della Cultura (non solo Medicina...)
C’era una volta il salone del barbiere
Francesco Iodice
XVI
Gironzolando per Napoli
Francesco Iodice
XIX
Recensione
I racconti di un medico
Lilia Giannini
XXII
Meeting Calendar
XXIV
6
MRM
Calverley Multidisciplinary Respiratory Medicine 2014, 9:26
http://www.mrmjournal.com/content/9/1/26
EDITORIAL
Open Access
Integrating COPD care in Italy
Peter MA Calverley
Doctors are not short of advice about how to manage
their patients. In the case of COPD (Chronic Obstructive Pulmonary Disease) there are a wealth of guidelines,
strategies and position papers synthesising an increasing
body of data from observational studies and clinical trials into schemes that should help the doctor care for
their COPD patients more effectively. In recent years
particular attention has been paid to the views of the
joint ERS/ATS COPD guidelines [1] and the regularly
updated recommendations of the Global initiative for
chronic Obstructive Lung Disease (GOLD) [2]. Now a
new Italian document has been developed representing
the combined efforts of three key Italian respiratory societies AIMAR, AIPO, SIMeR and the society of General
Practice, SIMG, whose combined expertise covers almost
all those who offer care to the COPD patient. So what
does this new guidance tell us and does it add to what we
have heard already?
Appropriately this new document takes a very wide
view of the problems of COPD. It emphasises the need
for early accurate diagnosis supported when needed but
supplementary physiological investigations such as the
measurement of lung volumes and airway responsiveness. It points out the limitations of relying on a fixed
FEV1/FVC ratio of 70% or less to support the diagnosis
of COPD and suggest instead that the lower limit of normal (LLN) for this ratio is a more reliable guide. There
might have been a little more advice for the busy clinician on the best way of accessing appropriate LLN data
and perhaps a little more caution on the usefulness of
bronchodilator testing in patient evaluation [3]. However
there are some excellent figures to guide diagnosis and
management as well as useful tabular summaries of what
tests should be undertaken by which clinicians and how
to approach smoking cessation.
The authors have avoided some of the controversy and
uncertainty surrounding the new GOLD severity assessment scheme [4], instead focussing on patient sub-groups
that correspond to those seen in clinical practice and in
clinical trials. Their treatment recommendations are not
formally evidence based but closely follow those in guidelines where more extensive evidence evaluations have
been conducted [5]. The authors offer clear practical guidance with support from selected but relevant literature citations which help the clinician understand why particular
treatment choices have been made. There is an appropriate and pragmatic section emphasising the value of pulmonary rehabilitation together with a particularly helpful
review of the role of telemedicine in COPD care, a topic
scarcely touched on in other guidelines.
This new approach to COPD care is needed in Italy now.
As the authors point out, COPD remains a major health
problem despite much good work to increase smoking cessation rates and improve air quality. International guidelines offer an overview of COPD care in all settings but
there is still a need to develop management strategies
which work locally and reflect the needs and perceptions
of local physicians and patients. This new initiative has
achieved both of these goals admirably.
Received: 25 April 2014 Accepted: 25 April 2014
Published: 19 May 2014
References
1. Celli BR, MacNee W: ATS/ERS Task Force: Standards for the diagnosis and
treatment of patients with COPD: a summary of the ATS/ERS position
paper. Eur Respir J 2004, 23(6):932–946.
2. Vestbo J, Hurd SS, Agusti AG, Jones PW, Vogelmeier C, Anzueto A, Barnes PJ,
Fabbri LM, Martinez FJ, Nishimura M, Stockley RA, Sin DD, Rodriguez-Roisin R:
Global strategy for the diagnosis, management, and prevention of chronic
obstructive pulmonary disease: GOLD executive summary. Am J Respir Crit
Care Med 2013, 187(4):347–365.
3. Calverley PM, Albert P, Walker PP: Bronchodilator reversibility in chronic
obstructive pulmonary disease: use and limitations. Lancet Respir Med
2013, 7:564–573.
4. Calverley PM: The ABCD of GOLD made clear. Eur Respir J 2013, 42(5):1163–1165.
5. O’Reilly J, Jones MM, Parnham J, Lovibond K, Rudolf M: Guideline
Development Group: Management of stable chronic obstructive
pulmonary disease in primary and secondary care: summary of updated
NICE guidance. BMJ 2010, 340:c3134.
doi:10.1186/2049-6958-9-26
Cite this article as: Calverley: Integrating COPD care in Italy.
Multidisciplinary Respiratory Medicine 2014 9:26.
Correspondence: [email protected]
School of Ageing and Chronic Disease, University of Liverpool, Liverpool, UK
© 2014 Calverley; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
POSITION PAPER
Open Access
The clinical and integrated management of COPD.
An official document of AIMAR (Interdisciplinary
Association for Research in Lung Disease), AIPO
(Italian Association of Hospital Pulmonologists),
SIMER (Italian Society of Respiratory Medicine),
SIMG (Italian Society of General Medicine)
Germano Bettoncelli1, Francesco Blasi2, Vito Brusasco3, Stefano Centanni4, Antonio Corrado5,
Fernando De Benedetto6, Fausto De Michele7, Giuseppe U Di Maria8, Claudio F Donner9*, Franco Falcone10,
Carlo Mereu11, Stefano Nardini12, Franco Pasqua13, Mario Polverino14, Andrea Rossi15 and Claudio M Sanguinetti16
Abstract
COPD is a chronic pathological condition of the respiratory system characterized by persistent and partially
reversible airflow obstruction, to which variably contribute remodeling of bronchi (chronic bronchitis), bronchioles
(small airway disease) and lung parenchyma (pulmonary emphysema). COPD can cause important systemic effects
and be associated with complications and comorbidities. The diagnosis of COPD is based on the presence of
respiratory symptoms and/or a history of exposure to risk factors, and the demonstration of airflow obstruction by
spirometry. GARD of WHO has defined COPD “a preventable and treatable disease”. The integration among general
practitioner, chest physician as well as other specialists, whenever required, assures the best management of the COPD
person, when specific targets to be achieved are well defined in a diagnostic and therapeutic route, previously designed
and shared with appropriateness. The first-line pharmacologic treatment of COPD is represented by inhaled long-acting
bronchodilators. In symptomatic patients, with pre-bronchodilator FEV1 < 60% predicted and ≥ 2 exacerbations/year, ICS
may be added to LABA. The use of fixed-dose, single-inhaler combination may improve the adherence to treatment.
Long term oxygen therapy (LTOT) is indicated in stable patients, at rest while receiving the best possible treatment, and
exhibiting a PaO2 ≤ 55 mmHg (SO2 < 88%) or PaO2 values between 56 and 59 mmHg (SO2 < 89%) associated with
pulmonary arterial hypertension, cor pulmonale, or edema of the lower limbs or hematocrit > 55%. Respiratory
rehabilitation is addressed to patients with chronic respiratory disease in all stages of severity who report symptoms
and limitation of their daily activity. It must be integrated in an individual patient tailored treatment as it improves
dyspnea, exercise performance, and quality of life. Acute exacerbation of COPD is a sudden worsening of usual
symptoms in a person with COPD, over and beyond normal daily variability that requires treatment modification. The
pharmacologic therapy can be applied at home and includes the administration of drugs used during the stable phase
by increasing the dose or modifying the route, and adding, whenever required, drugs as antibiotics or systemic
corticosteroids. In case of patients who because of COPD severity and/or of exacerbations do not respond promptly to
(Continued on next page)
* Correspondence: [email protected]
9
Mondo Medico, Multidisciplinary and Rehabilitation Outpatient Clinic,
Borgomanero, NO, Italy
Full list of author information is available at the end of the article
© 2014 Bettoncelli et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public
Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this
article, unless otherwise stated.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 2 of 16
(Continued from previous page)
treatment at home hospital admission should be considered. Patients with “severe” or “very severe” COPD who
experience exacerbations should be carried out in respiratory unit, based on the severity of acute respiratory failure.
An integrated system is required in the community in order to ensure adequate treatments also outside acute care
hospital settings and rehabilitation centers. This article is being simultaneously published in Sarcoidosis Vasc Diffuse Lung
Dis 2014, 31(Suppl. 1);3-21.
Keywords: COPD, Integrated care, Management
Introduction
Respiratory diseases currently represent the second cause
of death worldwide, though they are underestimated. Because of the increasing life span of general population and
the persisting smoking habit, chronic obstructive pulmonary disease (COPD) is expected, based on the current
trends of incidence, to become the third cause of death
worldwide by 2020.
Symptoms of COPD, cough, phlegm, and dyspnea, are
often overestimated and the diagnosis is made only in
the sixth decade of life, when the patients are already in
the moderate-to-severe stage and lung function is impaired. Frequently, the diagnosis is made when the patient is hospitalized because of an exacerbation, which
points to the inadequacy of the current standards for
diagnosis and treatment.
This document is an update of the COPD guidelines
published in Italy by the National Agency for Regional
Health Services (AGE.NA.S.) and is intended to offer an
instrument for practical and integrated management of
COPD, aiming at appropriateness of diagnosis and therapy.
The document is addressed to pulmonologists and other
specialists working either inside or outside hospitals, general practitioners, other health professionals, patient’s associations, and institutions at national, regional, or local level.
Figure 1 shows general guidelines for COPD management.
The document has been prepared by a working group
appointed by the three major national respiratory societies (AIMAR, AIPO e SIMeR) and the Italian Society of
General Medicine (SIMG). Representatives of the Italian
Ministry of Health and AGE.NA.S. were involved as external independent observers to warrant for ethical, social and solidarity principles.
The reference list of each chapter is meant to be essential and not exhaustive regarding the information given.
Methodological note
Health Information is the spread of any health-related information, without assessment of the impact that the message has on addressees. It can be done by direct verbal
messages, movies, brochures, posters, or other media (e.g.
web) [1,2].
Health Education is a set of general information on behavioral norms, knowledge, attitudes, habits and values
that contribute to expose to or protect from harm to health.
It applies to both healthy and sick people. It includes general norms that can be learnt in different contexts, such as
family, school, society and health organizations [1,2].
Therapeutic Education is a set of educational activities
in favor of specific categories. It is put into action by
transmission of knowledge, training to achieve skills and
promote behavioral changes. It requires that educators
have specific knowledge of science and communication,
with proficiency in the use of specific methodologies and
verification of results [3].
The goal of Health Education is to improve the efficacy of treatments for chronic pathological conditions
through the active and responsible participation of patient to therapeutic plan. The improvement of life-style
in support of treatments and the participation in the
choice of changes account for a greater efficacy of treatments and psycho-physical personal well-being.
COPD definition and diagnosis
Definition
COPD is a chronic pathological condition of the respiratory
system characterized by persistent and not fully reversible
airflow obstruction, to which variably contribute pathologic
change of bronchi (chronic bronchitis), bronchioles (small
airway disease) and lung parenchyma (pulmonary emphysema). COPD is caused by the inhalation of noxious agents,
mainly tobacco smoke, which cause chronic inflammation
by various mechanisms. Clinical manifestations are chronic
cough and phlegm, dyspnea and reduced exercise tolerance.
Pathophysiology
Chronic airflow obstruction is the results of a combination of various abnormalities differing for type, site, severity and extent. In a number of patients, perhaps the
majority, the reduced caliber of airways, mainly the more
peripheral ones with a diameter < 2 mm [1,4], due to inflammation, mucous hypersecretion and remodeling,
and the destruction of lung parenchyma may cause:
Static lung hyperinflation, i.e., an increase in the
volume at which lung and chest wall are at static
equilibrium, due to reduction of lung elastic recoil
pressure.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 3 of 16
Figure 1 General guidelines for prevention and care of chronic respiratory diseases.
Dynamic lung hyperinflation, i.e., an increase of end-
expiratory lung volume above the static equilibrium
volume, due to increased airflow resistance. In more
severe patients it may be present even at rest; in less
severe ones it occurs when either minute ventilation
is increased, e.g., during exercise, or airflow resistance
is further increased, e.g., during exacerbations.
Ventilation-Perfusion mismatching.
COPD can cause important systemic effects and be associated with complications and comorbidities, common
in elderlies or more severe cases. COPD is the commonest cause of chronic respiratory failure and disability.
Diagnosis
The diagnosis of COPD is based on a history of exposure to risk factors, either associated or non-associated
with respiratory symptoms, and the demonstration of
airflow obstruction by (simple) spirometry and additional pulmonary function tests.
A ratio of 1-s forced expiratory volume (FEV1) to vital
capacity (FEV1/VC) remaining below the limit of normality
15–30 min after the inhalation of a bronchodilator (salbutamol 400 μg) is sufficient to confirm the diagnosis. The
fixed ratio FEV1/FVC < 70%, frequently used as a lower
limit of normality yields falsely negative results in subjects
aged < 50 years and falsely positive results in those aged >
50 years [5-7]. Therefore, the use of the 95° percentile of
predicted FEV1/VC for age and sex is recommended. It
must also be noted that the vital capacity measured with a
forced expiratory maneuver (FVC) may be underestimated
compared with that measured with a slow maneuver
(VC). The functional abnormality of COPD can be characterized by comprehensive physiological studies, which
should be included in the diagnostic process in addition to
simple spirometry. These include the measurement of absolute lung volumes, particularly residual volume [8] and
functional residual capacity, and lung diffusion capacity
for carbon monoxide (DLCO) to evaluate the degree of
lung hyperinflation, gas trapping, and the presence of pulmonary emphysema [9,10].
Spirometry is a necessary investigation to confirm the
diagnosis of COPD and represents, together with symptoms, quality of life, frequency and severity of exacerbations,
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
and frequency of hospitalizations, a major criterion to
evaluate clinical condition and to make choice of the most
appropriate treatment. If the subject is unable to perform
acceptable spirometry maneuvers, the doctor should treat
him/her as “suspected COPD” based on history and clinical data. Persisting or recurrent episodes of cough,
sputum for several consecutive days and respiratory infections (cold, flu-like syndrome, bronchitis) with slow resolution and, mainly, dyspnea disproportioned to effort or
age are signs that must be reported to the general practitioner. This is in charge of recording the respiratory symptoms of his/her patient (also using the respiratory risk
chart for COPD) and referring him/her for appropriate
diagnostic investigations, particularly spirometry and/or
pulmonologist’s visit. General practitioners are also in
charge for active search of new cases, through the use of
questionnaires suitable for case finding among individuals
potentially affected by COPD. The use of an electronic
record carefully updated with patient’s data enables the
general practitioner and the specialist to monitor disease
progression. Scientific societies must be active in pursuing
this goal, while the central and local Institutions must
Page 4 of 16
sensitize the general population. Figure 2 shows the diagnostic procedure for COPD.
Integrated hospital and primary care of the
patient with stable COPD
The Global Alliance against Chronic Respiratory Diseases
(GARD) of the World Health Organization (WHO) has
defined COPD “a preventable and treatable disease”;
hence a great responsibility is cast on government and
health local Authorities, on Hospital Chest Physicians, on
primary care Physicians and staff and, last but not least,
on scientific societies.
GARD recommends that National Health Systems
works to get the following goals:
Figure 2 Proposal of diagnostic procedure and case finding for COPD.
total tobacco control (as a cause of COPD) and
control of other (less relevant) risk factors;
health education driven actions toward general
population for primary and secondary prevention;
COPD screening with simple and affordable means;
professional education of health staff to risk factors
(primary prevention), to screening procedures (also
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
identifying individuals with personal characters
putting them at risk of developing COPD) and to
optimal and sustainable treatments;
patient education to self management of COPD;
a COPD care network of health staff aimed at
integrating the current fragmented ultra-specialistic
knowledges using well known, shared guidelines and
protocols.
Follow up of stable COPD patient
Key points
The management of a person suffering from COPD can
reach high complexity levels during the advanced stages
when reduced gas exchanges, reduced exercise capacity,
increasing breathleness and important cardio-vascular,
metabolic, oncologic and psychiatric comorbidities can
be associated with a severe functional deficit.
This sub-population of patients with advanced COPD,
even if a small proportion of the total population, is responsible for the highest use of heath system resources,
having a strong impact on NHS. It requires a complex
management, coordinated between specialized and primary care. The best management can be attained with a
careful integration among chest physician, general practitioner as well as other specialists, whenever required.
For each health professional specific tasks should be
defined, which should be included in diagnostic and
therapeutic pathways, previously designed and shared
for each severity stage of the disease.
Table 1 shows the proposals for the follow up of
COPD, according to different severity stages. Which type
of control, by which health professional and at what time
is carried out are also specified.
Management of COPD in stable state
Key points
COPD is a chronic and complex condition which usually
tends to worsen over time. To control this evolution it is
necessary to quit smoking and eliminate risk factors as
well as to comply with the proper treatment (both
pharmacologic and non-pharmacologic) which should be
continued over time and tailored to the individual person needs, using clinical sings and functional test to step
up the treatment.
Also comorbidities (mainly cardiovascular and metabolic) and complications should lead the choice of the
treatment.
Smoking cessation is the first and most important treatment for coping with COPD. If it is impossible to eliminate any other risk factors, then a strict control of the
characters of life and work environment is mandatory.
General practitioners should record a complete smoking
history and current status of their patients on their data
bases. They are entitled to a minimal advice, which - on
Page 5 of 16
the existing evidences - has been shown effective and
cost-effective.
If a person diagnosed as COPD is not able to quit
smoking with the minimal advice - since smoking cessation is an essential therapeutic measure for these patients - then he/she is entitled to a pharmacologic and
behavioural treatment (second level intervention) [1].
To-date nicotine replacement therapy (NRT) in different pharmacologic forms (patch, chewing gum, inhaler,
lozanges), varenicline and slow- release bupropion (bupropion-SR) are considered first line treatment When
the prescription of one of these drugs is coupled with a
cognitive- behavioural treatment, a statistically significant higher percentage is granted of continuous abstinence (see Table 2).
Every Chest Physician should include smoking cessation therapy in the treatment of the smoker COPD patient. He/she should also refers the patient to a smoking
cessation clinic whenever necessary [2].
There is an ongoing debate about the use of ecigarette in a smoking cessation therapy [3]. Furthermore, encouragement is also necessary for the COPD
patient to live lifestyles able to contrast sedentariness,
overweight and social isolation.
Pharmacotherapy
It has been widely demonstrated that, in COPD patients,
regular pharmacotherapy improves symptoms, lung function, and exercise tolerance [1-3]. Furthermore, regular
pharmacotherapy can reduce the rate of decay of lung
function [4-7], and decrease the frequency and severity of
exacerbations [8-15] as well as the number and length of
hospitalizations [14-20].
The main goal of the maintenance pharmacotherapy
of COPD is bronchodilation. Inhaled long-acting bronchodilators are the first-line treatment for stable COPD
[LABA (long-acting beta2 agonists): formoterol, salmeterol, indacaterol. LAMA (long-acting muscarinic antiagonists): tiotropium, glycopyrronium, aclidinium].
Recommendations
The prescription and maintenance of pharmacotherapy
needs:
1. The confirmation of the diagnosis of COPD having
ascertained the presence of risk factors, respiratory
symptoms, and spirometric evidence of airflow
obstruction.
2. An active and personalized smoking cessation
program.
3. The strong recommendation for a healthier lifestyle:
healthy nutrition program, and weight control;
regular physical activity;
social life.
Respiratory function unit
Chest physician
Other consultation and/ or tests*
General practitioners are in charge
of chronic treatment monitoring:
Every three months he/she checks
the clinical situation in own clinic.
Refers the patient to a consultation
in case of exacerbation. Chest
physician has in charge the patient
until the recovery of the steady
state
Respiratory function unit
Other consultation and/ or tests*
General practitioners are in charge of
chronic treatment monitoring: Every six
months he/she checks the clinical
situation in own clinic. He/she carries
out a pulsoximetry at each
exacerbation and the following
2 months. Refers the patient to a
consultation in case of persistent
worsening
Nocturnal pulsoximetry*
Other consultation and/or tests*
General practitioners are in charge of
chronic treatment monitoring. Every
two months he/she checks the
clinical situation in own clinic. Quickly
refers the patient to a consultation in
case of exacerbation or complaint
of new symptoms/signs. Chest
physician has in charge the patient
until the recovery of the steady
state and monitors the comorbidities,
using the proper referrals
Other consultation and/ or tests*
Respiratory function unit
Respiratory function unit
Respiratory function unit
Specialized unit
Chest physicians and general
practitioner
Radiology
Respiratory function unit
Respiratory function unit
Chest physician
Chest physicians and general
practitioner
Chest physicians and general
practitioner
Chest physicians and general
practitioner
Every physician/nurse or smoking
cessation clinic
Every year
Monitoring COPD with FEV1 < 50%
with respiratory insufficiency and
comorbidity**
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
(*) when needed (**) patient in OLTT deserves BGA and clinical check at least every six-month.
Respiratory function unit
Respiratory function unit
Respiratory function unit
Respiratory function unit
Specialized unit
6-min walking test
Specialized unit
Chest physicians and general
practitioner
Radiology
Respiratory function unit*
Respiratory function unit
Chest physician
Chest physicians and general
practitioner
Chest physicians and general
practitioner
Chest physicians and general
practitioner
Every physician/nurse or smoking
cessation clinic
Every year
Monitoring COPD with FEV1 < 60%
and/or exercise dyspnea and/or
frequent exacerbations and/or
comorbidities
Blood gas analysis (BGA)
EKG cardiac ultrasound
Chest physicians and general
practitioner
Chest physicians and general
practitioner
Full spirometry
EKG*
Chest physician consultation
Chest physicians and general
practitioner
Radiology
Chest physician
Respiratory function unit*
Flow-volume curve
Chest physicians and general
practitioner
Respiratory function unit*
Chest physicians and general
practitioner
Pulsoximetry
Chest physicians and general
practitioner
Radiology
Chest physicians and general
practitioner
Clinical check (including Body
Mass Index, questionnaires
and assessment of risk factors)
Every physician/nurse or smoking
cessation clinic
Every year
Chest-X-ray*
Chest physicians and general
practitioner
Smoking cessation, if a smoker
Monitoring COPD with FEV1 < 80%
and/or exercise dyspnea and/or
comorbidities
Diffusion test (DLCO)
Every other year
Every physician/nurse or
smoking cessation clinic
Timing
Monitoring chronic bronchitis
(without flow limitation) or
mild COPD (FEV1/CV < LLN
and FEV1 > 80%) without
symptoms
Planned actions
Table 1 Planning COPD monitoring
MRM volume 9 3-4_Layout 1 28/07/14 20:27 Pagina 14
Page 6 of 16
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 7 of 16
Table 2 Smoking cessation therapy (Modified from MC
Fiore, 2008)
the frequency of hospitalizations and the length of
Type of intervention
the adverse events.
stay;
Odds ratio
(95% C.I.)
Abstinence rate
(95% C.I.)
None
1.0
10.9
Minimal advice (<3 min)
1.3 (1.01-1.06)
13.4 (10.9-16.1)
Counseling 3–10 min
1.6 (1.2-2.0)
16.0 (12.8-19.2)
Counseling > 10 min
2.3 (2.0-2.7)
22.1 (19.4-24.7)
an increase in the dose of the bronchodilator
Placebo
1.0
13.8
the addition of a second long-acting bronchodilator
Varenicline
3.1
33.2 (28.9-37.8)
Cognitive-behavioural treatment
Pharmacologic therapy
If the patient or/and the caring physician are not satisfied with the results of the prescribed long-acting bronchodilator monotherapy, one of the followings should be
considered:
according to its pharmacologic characteristics [26-29];
with a different mechanism of action [34-44];
the addition of inhaled corticosteroid (ICS), in
Nicotine replacement therapy (NRT)
Patch (6–14 weeks)
1.9 (1.7-2.2)
23.4 (21.3-25.8)
Chewing gum (6–14 weeks)
1.5 (1.2-1.7)
19.0 (16.5- 21.9)
Inhaler
2.1 (1.5-2.9)
24.8 (19.1-31.6)
SR Bupropion
2.0 (1.8-2.2)
24.2 (22.1-26.4)
4. Any therapeutic program must be tailored to the
characteristics of the individual patient with COPD
taking into account the severity of the overall
clinical status on the basis of symptoms, lung
function, complications, comorbidities, and, when
possible, the phenotype [21].
5. In symptomatic patients with a confirmed diagnosis
of COPD, dyspnea ≥ mMRC stage 1, and with prebronchodilator FEV1 ≥ 80% predicted [22] the caring
physicians may consider treatment with
bronchodilators [23].
6. Regular treatment with inhaled long-acting
bronchodilators is recommended in symptomatic
patients with a confirmed diagnosis of COPD and
pre-bronchodilator FEV1 < 80% predicted [16,24-33].
Two clinical studies showed a better protection to exacerbations for tiotropium compared to LABA although
both categories (LABA and LAMA) provided an effective
bronchodilation [14-16]. Furthermore, a recent clinical
study on a large population of patients has documented
the clinical safety of tiotropium for the available doses and
inhalers [17].
At any control visit, the followings should be evaluated:
the adherence to the maintenance therapy;
the changes in symptoms, and in particular in
dyspnea and exercise tolerance;
the changes in lung function: not only for FEV1, but
also lung volumes and, when needed, DLCO;
the use of rescue medications;
the rate and severity of exacerbations;
patients with frequent exacerbations [8,9,11,39-41].
7 In patients with COPD, who:
remain symptomatic despite the regular use of
long acting bronchodilator(s),
present a pre-bronchodilator FEV1 < 60% predicted
[9], and
suffer ≥ 2 exacerbations/year [45]
the addition of ICS to LABA may be considereda. The
use of a single inhaler fix dose combination LABA + ICS
may improve the adherence to treatment [8,9,11,46-49].
8 In those patients, the “triple therapy”, i.e. LAMA +
LABA + ICS, can improve lung function and quality
of life, and reduce the number of hospitalizations
[16,48,49].
9 In COPD patients with:
symptoms of chronic bronchitis,
pre-bronchodilator FEV1 < 50% predicted, and
frequent exacerbations, i.e. ≥ 2/year,
the addition of a phosphodiesterase-4 inhibitor (roflumilast) on top of regular treatment with long-acting bronchodilator(s) can further improve lung function and
reduce the exacerbation rate [50-54].
Conventionally, the airflow obstruction is defined as severe in COPD patients with FEV1 < 50% predicted and
very severe in those with FEV1 < 30% predicted. This classification is the result of an “expert agreement” and is not
either based on the evidence from prospective studies or
somehow correlated to the severity of the patient’s overall
clinical status. However, for operational and communication purposes, it may be useful to suggest a conventional
agreement on three stages of the severity of airflow obstruction, in patients with a FEV1/VC < 95° predicted [40]:
mild: FEV1 ≥ 80% predicted
moderate: FEV1 < 80% and ≥ 50% predicted
severe: FEV1 < 50% predictedb
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Some composite indices have been suggested to take
into account non only the lung function abnormalities
but also some other clinical aspects relevant for the
overall patient evaluation: BODE [55-57], DOSE [58],
ADO [59]. However their use in the clinical settings to
assess the status and the progression of COPD as well as
the effects of therapeutic strategies is limited [60].
Page 8 of 16
COPD patients aged less than 65 years, with severe
lung function and clinical impairment, FEV1 value less
than 20% of predicted, a history of frequent hospitalizations for exacerbation and requiring LTOT, should be referred for lung transplant evaluation, which has been
proven to have a positive impact on outcomes such as
lung function, exercise performance and quality of life,
whereas its impact on survival remains unproven [10,11].
Oxygen and non-pharmacological therapy
Severe COPD is commonly associated with respiratory
failure, which is characterized by arterial hypoxemia
(PaO2/FiO2 < 300 mmHg). Evidence suggests that chronic
hypoxemia with PaO2values less than 55–60 mmHg, if untreated by supplemental oxygen, leads to an increase in
mortality [1].
In such cases, a continuative long term oxygen therapy
(LTOT) is required, for a duration of at least 15 hours
[1] or, better, 18–24 hours a day [2]. Oxygen administration should be continued overnight at an average flow
rate of 1–2 L/min. Oxygen flow rate should be tailored
to maintain the PaO2 value and oxygen saturation
(SaO2%) above 60 mmHg and 92%, respectively.
In hypercapnic patients oxygen supplementation must
be provided at a low flow rate in order to avoid increases
of carbon dioxide retention and respiratory acidosis
(pH < 7.36) [3].
According to both national and international guidelines [4,5], LTOT is indicated in stable patients, at rest
while receiving the best possible treatment, and exhibiting a PaO2 ≤ 55 mmHg or PaO2 values between 56 and
59 mmHg associated with pulmonary arterial hypertension, cor pulmonale, o edema of the lower limbs or
hematocrit > 55% in consecutive arterial blood gas analyses obtained at an interval of at least fifteen days over
a two months period [5,6].
Efficacy of oxygen at the prescribed flow rate and persistence of the indication to LTOT should be verified at
intervals of 3 to 12 months after prescription [7] and, on
regular basis, at least once a year or whenever required
by clinical changes [5].
Patients with COPD and chronic respiratory failure
having frequent exacerbations requiring hospitalization,
and hypercapnia (PaCO2 > 45 mmHg) may benefit from
non-invasive ventilation (NIV) treatment [8], initiated
after evaluation by competent specialists.
In selected patients, lung function improvement
throughout surgical procedures such as bullectomy or
lung volume reduction either by resection of emphysematous lung parenchyma or insertion of unidirectional
endobronchial valves aimed to desufflate lung parenchyma or other bronchoscopic procedures still under
evaluation should be considered [9]. These procedures
should be reserved for thoroughly selected patients and
performed in reference centers.
Rehabilitation
Key points
Respiratory rehabilitation (RR) is defined as “a global
and evidence-based multidisciplinary intervention, aimed
at patients with chronic respiratory disease in all stages of
severity who report symptoms and limitation of their daily
activity.
If integrated in a tailored treatment for COPD, RR has
the purpose of controlling symptoms, optimizing the
performance status, improving participation and reducing healthcare costs by achieving clinical improvement
and/or stability.
Outcomes
Respiratory rehabilitation (RR) improves dyspnea, exercise performance and quality of life in COPD patients.
There is minor evidence for other outcomes such as prevention of complications and exacerbations, slowing of
disease progression and survival. In addition, RR seems
effective in cutting healthcare costs through a reduction
of emergency visits and hospitalization length. In contrast, RR has no impact on FEV1 decline and progressive
lung function deterioration in COPD.
Patient selection
Accurate patient selection and program personalization
are of major importance for the success of RR.
Contraindications
Age and disease severity do not represent contraindications to RR. Current smoking is not a contraindication
provided that the rehabilitation program includes sessions aimed at smoking cessation. Main contraindications are summarized in Table 3.
Structure of the rehabilitation program
A tailored rehabilitation program comprehends both
useful and mandatory activities in variable combination
depending on the initial assessment, and grouped in essential or fundamental and ancillary or complementary
(Table 4).
Assessment of results
Outcomes of RR are assessed with regard to every aspect
of COPD. Therefore assessment of improvement in lung
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 9 of 16
Table 3 Main contraindications to respiratory rehabilitation
Table 5 Indicators and outcomes
Absolute contraindications
Other contraindications
Indicators
Outcomes
Unwillingness to participate in the program
Linguistic barriers
Lung function assessment(m)
Improvement of exercise tolerance
Poor adherence to the program
Cognitive impairment
Exercise tolerance assessment(m)
Improvement of symptoms (dyspnea)
Socio-economic barriers
Dyspnea assessment(m)
Logistic barriers
(e.g. distance from hospital)
Improvement of the quality of
life (QoL)
Muscular assessment(c)
Increase in survival rates
Psychological assessment(c)
Control and rationalization of costs
(c)
function disability, and social impact of the disease are
currently used. The functional assessment is of major
importance at the initial evaluation to customize the RR
program. Indicators and outcomes are shown in Table 5.
Exacerbations
Key points
Patients with COPD experience exacerbations during
the natural course of their disease condition. Frequency
and severity of exacerbations are among the factors that
determine the prognosis of COPD.
COPD exacerbations are the leading cause of medical
consultations, hospitalizations and death among patients
with greater functional compromise. Among COPD patients, exacerbations may temporarily induce conditions
of relevant physical inability, even after hospital discharge.
A recent study indicates that susceptibility to exacerbations seems to remain constant over time, both among
frequent exacerbators (≥2 exacerbations per year), and
infrequent exacerbators (<2 events per year), irrespective
of underlying disease severity ([88-90]. Patients with
COPD who experience a greater number of exacerbations may be at higher risk of a more rapid decline in respiratory function [4,6].
It is of paramount importance to prevent exacerbations and to treat events promptly at symptom onset, in
order to reduce the impact of exacerbations on health
status and patient quality of life.
Up to 70% of the overall costs of COPD management
may be attributable to exacerbations, particularly to
those that require hospitalization.
Acute exacerbations of COPD (AECOPD) are defined
as an acute worsening of usual symptoms in a patient
with COPD (dyspnea, cough and sputum production),
over and beyond normal daily variability that requires
Table 4 Classification of rehabilitation activities
Nutritional assessment
Quality of life assessment(m)
(m)
Mandatory;
(c)
Complementary.
treatment modification, i.e. a course of systemic steroids
and/or antibiotics [1].
During a worsening of symptoms it is important to
distinguish true exacerbations from symptoms due to
other conditions such as pulmonary embolism [7,8],
congestive heart failure, pneumothorax, pneumonia, costal or vertebral fracture, inappropriate drug use (sedatives, narcotics and betablockers). The most common
causes of exacerbations are viral and/or bronchial infections of the tracheobronchial tree [9].
Preventing exacerbations
Measures that may be adopted for preventing exacerbations and their efficacy are summarized in Table 6.
Treatment of exacerbations
In the outpatient management of exacerbations, the first
step is the additional use of short acting bronchodilators
(SABA or SAMA) [10], by increasing the dose or modifying the route of administration of drugs used during
the stable phase.
There is evidence regarding the efficacy of administering systemic corticosteroids during an exacerbation. It is
Table 6 Measures that may be adopted in preventing
COPD exacerbations
Measure
Efficacy
Influenza vaccination
Documented efficacy
Long term tiotropium administration
Documented efficacy
Long term LABA administration
Documented efficacy
LABA + inhaled corticosteroid administration
Documented efficacy
LAMA + LABA + ICS
Documented efficacy
Complementary activities
Continuation of systemic steroid therapy
for a brief period after AECOPD
Documented efficacy
Fundamental activities
Optimization of pharmacotherapy
Respiratory muscle training
Respiratory rehabilitation
Documented efficacy
Training of upper and lower limbs
Chest physiotherapy
Smoking cessation
Documented efficacy
Health education
Nutritional support
Polysaccharide antipneumococcal vaccination
Controversial efficacy
Therapeutic education
Antioxidant-mucoactive drugs
Controversial efficacy
Psychologic and psychosocial support
Bacterial lysate
Possible efficacy
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
advisable not to exceed the dose of 30–40 mg a day of
prednisone for 7–14 days [11-13].
Antibiotics are particularly recommended in exacerbations where both increase in sputum volume and sputum
purulence are present [14-18]. There is no demonstration
that for single drugs parenteral administration is superior
to the oral route.
Notwithstanding prompt institution of treatment, some
patients do not respond to outpatient management and
may satisfy one or more criteria for hospital admission
(Table 7).
Strict adherence to these criteria is of extreme importance in order to reduce inappropriate hospital admission
for COPD exacerbations. In general terms, the presence
of comorbidities does not alter the treatment scheme for
COPD exacerbations. Comorbidities should be treated
independently. Hospital admission is justified particularly when respiratory failure develops or worsens as
testified by blood gas analysis. SpO2 values below 92%
suggest presence of hypoxemia.
In exacerbations with overt respiratory failure (PaO2/
FiO2 ≤ 300 mmHg) oxygen administration is necessary
to maintain pulseoxymetry (SpO2) ≥ 93%. Values ≥ 88%
may be considered acceptable when high flow oxygen
may precipitate hypercapnia [19-21].
In the presence of ventilatory failure (PaCO2 > 45 mmHg)
and/or respiratory failure (PaO2/FiO2 ≤ 300 mmHg and
PaCO2 > 45 mmHg) with respiratory acidosis (pH ≤ 7.35),
non invasive ventilation should be considered as it has
been shown to reduce mortality and the need for endotracheal intubation [19-22].
Integrated hospital-community management of
patients with severe COPD
Page 10 of 16
should be carried out in respiratory units with different intensity of management capacity (Monitoring Unit, Respiratory Intermediate Care Unit, Respiratory Intensive
Care Unit) [3-5]. When ARF is associated with multiple
organ failure the patient should be admitted to an Intensive Care Unit [4,5]. At discharge, collaboration between
hospital based specialists and general practitioner allows
continuing assistance with the use of targeted organizing
models.
The hospital discharge note is the first tool to guarantee continuing home assistance, as it should include indications on the severity of COPD, degree of functional
compromise as assessed by relevant lung function parameters, presence and severity of comorbidity, use of
inhaled therapy, and clinical follow up. It should also indicate whether the patient is an active smoker, and set a
treatment program to favour quitting.
Home care pathway
In the community, an integrated system is required in
order to ensure adequate levels of assistance outside acute
care hospital settings and rehabilitation centers [6-8]. This
may be obtained through shared computer systems for the
management of patients and the employment of a health
team that includes - in addition to a pulmonologist and
the general practitioner - other health professionals
(Table 8). All professionals involved should be organized
and integrated into a respiratory network evenly distributed throughout the community. The team should guarantee telematic monitoring, a second opinion service
active twenty four hours a day, home pulmonologist
examination, and prompt hospitalization in the presence
of foreseeable clinical critical conditions.
Hospital management of the acute phase
Patients with “severe” or “very severe” COPD who experience exacerbations should be hospitalized. Based on the
severity of acute respiratory failure (ARF) [1-2] treatment
Table 7 Criteria for appropriate hospital admission for
COPD exacerbations
• Inadequate or failed response to outpatient treatment
• Presence of high risk comorbidity (pneumonia, arrhythmia, congestive
heart failure, diabetes, liver or renal failure) or very elderly patients
• Past history of frequent exacerbations
• Significant increase in dyspnea and/or onset of new signs
(cyanosis, peripheral edema, arrythmias)
• Significant worsening in hypoxemia
• Worsening in hypercapnia/respiratory acidosis (not detectable at the
patient bedside)
Palliative and end of life care in COPD
Palliative care should be integrated within the treatment
plan for patients with COPD [9-11] and be initiated
when symptoms such as dyspnea, pain, depression, anxiety and constipation are not completely controlled by
standard pharmacological treatment.
The term palliation encompasses interventions aimed
at preventing and relieving patient suffering through
symptom control, so as to stabilize or improve quality of
life.
Table 8 Health professionals involved in home
management of patients with respiratory failure
• Reference physician for Home Care
• Trained nurse
• Mental status alterations
• Respiratory therapist for rehabilitation
• Lack of or unreliable family assistance
• Psychologist
• Diagnostic uncertainty
• Dietician/nutritional counsellor
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
The concept of end of life assistance is instead reserved to the terminal phase of the disease and implies
“comfort” or support measures for both the sick person,
and for his/her family members [10].
Palliation and end of life care require multidisciplinary
involvement of physicians, nurses, physiotherapists, psychologists, social workers, home care providers, and
clericals when requested [11].
Page 11 of 16
Table 10 Critical aspects in teleassistance
• Possible loss of direct patient-physician contact
• Personal data
• Difficulties in accessing the assistance web
• Poor interactivity between computer systems
• Paucity of uniform political strategies across the nation
• Paucity of definitive data on the efficacy of the system
• Absence of specific legislation on the aspects of security regarding
both the patient and the prescribing physician
Telemedicine and teleassistance
The management of chronic conditions and continuing
assistance may be greatly improved through the application of innovative technologies, among which telemedicine, teleassistance and more in general Information and
Communication Technology (ICT). Application of these
systems is particularly useful in guaranteeing a networkbased operative frame for taking charge of patients with
chronic disease. The National Program for Research and
Formation in Telemedicine [12] indicates telemedicine
as “a particular means of providing health assistance
from community-based institutions, that allows integrated delivery of diagnostic and management medical
measures, overcoming the barriers associated with territorial distribution of different competences, bridging
the gap between subscribers and the experts, and reducing temporal fragmentation of interventions on single
patients”.
The use of telemedicine tools is aimed at reaching a
greater degree of interaction between the community
and reference clinical centers, reducing the need for
transferral of frail and often elderly patients. Telemedicine guarantees contacts between centres with different clinical expertise, dialogue through equipment
present in the patient’s home, assistance to remote or
isolated areas, emergency interventions, solidarity to
low income countries. The Italian National Health Plan
for the years 2011–2013 [13] underlines the need for
telemedicine implementation in order to guarantee
access to specific health assistance. Tables 9 and 10
respectively summarize the aims and critical issues of
teleassistance.
The role of institutions
In consideration of organisational and institutional competences, it is helpful that central institutions (which are
in charge) do ensure the training of an appropriate number of Specialists for the needs of assistance. Furthermore, in consideration of the epidemiological data, the
Ministry of Health and Regional Health Institutions do
insert a specific section for acute and chronic respiratory
diseases in their planning, namely for COPD; the Regions and Local Health Units do their best for the
reinforcement and homogeneity of the network for lung
function assessment. At the same time it is helpful that
in the whole country the distribution of Pulmonary Divisions with Units of Respiratory Intensive Care or Intermediate Intensive Units or Respiratory Monitoring Units
is organized according to precise criteria of inhabitants
number and/or extension of the area. In addition it should
be realized, at least at regional level, a telemonitoring service active twenty four hours a day through a call center,
which can telematically receive all the parameters that
should be monitored (pneumological teleassistance), and
at the same time can guarantee a comprehensive healthcare support to the patient with respiratory failure. Furthermore, it is helpful that in every region some
rehabilitation centers for post-acute patients can be found,
with a ratio of day-beds suitable for population; at the
same time, centers of outpatient respiratory rehabilitation
can be active in every Local Health Unit and able to give
the care needed by the patient in the steady phase of the
disease, with costs under control. Last, it is important the
Ministry of Health includes the therapeutical education
even in the LEAs (Essential Levels of Healthcare) of
COPD patient.
Table 9 Aims of teleassistance
• Improve patient quality of life
• Improve family member’s quality of life
• Increase the degree of patients safety at home
• Avoid hospitalizations
• Reduce outpatient general practitioner consultations
• Reduce outpatient respiratory specialist consultation
• Reduce need for patient transferral, and associated costs
Endnotes
a
EMA–AIFA for salmeterol 50/fluticasone 500 mcg
bid “symptomatic treatment of COPD patients with
FEV1 < 60% predicted (pre-bronchodilatar) and a clinical history of frequent exacerbations, with important
symptoms notwithstanding the regular therapy with
bronchodilators”.
b
It must be considered as pre-bronchodilator.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 12 of 16
Competing interests
The authors declare that they have no competing interests.
6.
Acknowledgements
The Authors thank the following representatives of the Italian Ministry of
Health and AGE.NA.S. (National Agency for Regional Health Services)
involved as external independent observers to warrant for ethical, social and
solidarity principles. Paola Pisanti, General Manager, Department of Health
planning, healthcare and ethics, Ministry of Health; Bruno Rusticali, Scientific
Coordinator AGE.NA.S. Guidelines.
7.
Note
This article is available in a different format in Sarcoidosis Vasc Diffuse Lung
Dis 2014, 31(Suppl. 1):3–21, Multidisciplinary Respiratory Medicine-paper
version 2013, 8(3–4):I-XV, Rassegna di Patologia dell’Apparato Respiratorio
2013, 28(5):235–250, Rivista Società Italiana di Medicina Generale 2014, 1:5–19
and in AIMAR, AIPO, SIMeR and SIMG websites (www.aimarnet.it, www.
aiponet.it, www.simernet.it, www.simg.it).
9.
Author details
1
General Practitioner, Brescia, Italy. 2Respiratory Diseases, Cà GrandaOspedale
Maggiore Milano Foundation, ‘UniversitàdegliStudi’ of Milan, Milan, Italy.
3
Respiratory Diseases, ‘UniversitàdegliStudi’ of Genua, Genua, Italy.
4
Respiratory Diseases, San Paolo Hospital, ‘UniversitàdegliStudi’ of Milan,
Milan, Italy. 5Intensive Therapy and Thoracic Pathophysiology, Careggi
Hospital, Florence, Italy. 6Pneumology Unit, SS. Annunziata Hospital, Chieti,
Italy. 7Pneumology I and Respiratory Pathophysiology Unit, A. Cardarelli
Hospital, Naples, Italy. 8School of Specialization in Respiratory Diseases,
Pulmonology Unit and Sleep Medicine, Department of Clinical and Molecolar
Biomedicine, University of Catania, Catania, Italy. 9Mondo Medico,
Multidisciplinary and Rehabilitation Outpatient Clinic, Borgomanero, NO, Italy.
10
Department of Pneumology, GVM Care & Research, Villalba & Villa Torri
Hospital, Bologna, Italy. 11Pneumology Department and Medical Field
Department, ASL 2, Savona, Italy. 12Pulmonary and TB Unit, Vittorio Veneto
General Hospital, − ULS 7- Veneto Region, Vittorio Veneto, TV, Italy.
13
Pneumology Rehabilitation, IRCCS S. Raffaele, Rome, Italy. 14North Salerno
Lung Diseases Pole, ASL SA, Salerno, Italy. 15Pneumology Unit, University and
General Hospital of Verona, Verona, Italy. 16Past Director, Pneumology
Unit-UTIR, San Filippo Neri General Hospital, Rome, Italy.
Received: 14 April 2014 Accepted: 15 April 2014
Published: 19 May 2014
Appendix
References regarding paragraph “Introduction” and “Methodological note”
1. Warsi A, Wang PS, LaValley MP, Avorn J, Solomon DH: Self management
education programs in chronic disease: a systematic review and
methodological critique of the literature. Arch Intern Med 2004,
164:1641–1649.
2. WHO Working Group Report: Therapeutic Patient Education: Continuing
education programmes for healthcare providers in the field of prevention of
chronic diseases. Copenhagen: WHO Regional Office for Europe; 1998.
3. Ministero Salute: Quaderno “Appropriatezza clinica, strutturale, tecnologica e
operativa per la prevenzione, diagnosi e terapia dell’obesità e del diabete
mellito”.
References regarding paragraph “COPD Definition and diagnosis”
1. Hogg JC, Macklem PT, Thurlbeck WM: Site and nature of airway
obstruction in chronic obstructive lung disease. N Engl J Med 1968,
278:1355–1360.
2. Cosio M, Ghezzo H, Hogg JC, Corbin R, Loveland M, Dosman J, Macklem PT:
The relations between structural changes in small airways and
pulmonary-function tests. N Engl J Med 1978, 298:1277–1281.
3. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM,
Rogers RM, Sciurba FC, Coxson HO, Paré PD: The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Eng J Med 2004,
350:2645–2653.
4. Barnes PJ: Small airways in COPD. N Engl J Med 2004, 350:2635–2637.
5. Celli BR, Halbert RJ, Enright P, Brusasco V: Should we abandon FEV1/FVC <
0.70 to detect airway obstruction? No/Yes. Chest 2010, 138:1037–1042.
8.
10.
Sorino C, Battaglia S, Scichilone N, Pedone C, Antonelli-Incalzi R, Sherrill D,
Bellia V: Diagnosis of airway obstruction in the elderly: contribution of the
SARA study. Int J COPD 2012, 7:389–395.
Mannino DM, Diaz-Guzman E: Interpreting lung function data using 80%
predicted and fixed thresholds identifies patients at increate risk of
mortality. Chest 2012, 141:73–80.
O’Donnell DE, Aaron S, Bourbeau J, Hernandez P, Marciniuk DD, Balter M,
Ford G, Gervais A, Goldstein R, Hodder R, Kaplan A, Keenan S, Lacasse Y,
Maltais F, Road J, Rocker G, Sin D, Sinuff T, Voduc N: Canadian Thoracic
Society recommendation for management of chronic obstructive
pulmonary disease - 2007 update. Can Respir J 2007, 14:5b–32b.
Saetta M, Ghezzo H, Kim WD, King M, Angus GE, Wang NS, Cosio MG: Loss
of alveolar attachments in smokers. A morphometric correlate of lung
function impairment. Am Rev Respir Dis 1985, 132:894–900.
Siafakas NM, Vermeire P, Pride NB, Paoletti P, Gibson J, Howard P, Yernault JC,
Decramer M, Higenbottam T, Postma DS, Rees PJ, on behalf of the Task Force:
Optimal assessment and management of chronic obstructive pulmonary
disease. ERS, consensus statement. Eur Respir J 1995, 8:1398–1420.
References regarding paragraph “Management of COPD in stable state”
1. Fiore MC: Treating tobacco use and dependance: 2008 Update. US Department
of Health and Human Services, Ministerodella Salute. Istituto Superiore di
Sanità. Linee guida cliniche per promuovere la cessazione dell’abitudine al
fumo. Aggiornamento 2008. www.iss.it/ofad.
2. Tønnesen P, Carrozzi L, Fagerström KO, Gratziou C, Jimenez-Ruiz C, Nardini S,
Viegi G, Lazzaro C, Campell IA, Dagli E, West R: Smoking cessation in
patients with respiratory diseases: a high priority, integral component of
therapy. Eur Respir J 2007, 29:390–417.
3. Implicazioni relative alla salute derivanti dall’uso della sigaretta elettronica:
Documento di posizione congiunto dell’Associazione Italiana Pneumologi
Ospedalieri (AIPO) e della Società Italiana di Medicina Respiratoria (SIMeR).
Aprile 2013. www.aiponet.it; www.simernet.it.
References regarding paragraph “Pharmacotherapy”
1. Centre NCG: Chronic Obstructive Pulmonary Disease: Management of Chronic
Obstructive Pulmonary Disease in Adults in Primary and Secondary Care.
London: National Clinical Guideline Centre; 2010. Available from: http://
guidance.nice.org.uk/CG101/Guidance/pdf/English.
2. Qaseem A, Wilt TJ, Weinberger SE, Hanania NA, Criner G, van der Molen T,
Marciniuk DD, Denberg T, Schünemann H, Wedzicha W, MacDonald R,
Shekelle P; American College of Physicians; American College of Chest
Physicians; American Thoracic Society; European Respiratory Society:
Diagnosis and management of stable chronic obstructive pulmonary
disease: a clinical practice guideline from the ACP, ACCP, ATS and ERS.
Ann Intern Med 2011, 155:179–191.
3. Vestbo J, Hurd SS, Agustì AA, Jones PW, Vogelmeier C, Anzueto A, Barnes PJ,
Fabbri LM, Martinez FJ, Nishimura M, Stockley RA, Sin DD, Rodriguez-Roisin R:
Global strategy for the diagnosis, management, and prevention of
chronic obstructive pulmonary disease. GOLD executive summary. Am J
Respir Crit Care Med 2013, 187:347–365.
4. Celli BR, Thomas NE, Anderson JA, Ferguson GT, Jenkins CR, Jones PW,
Vestbo J, Knobil K, Yates JC, Calverley PM: Effect of pharmacotherapy on
rate of decline of lung function in chronic obstructive pulmonary disease.
Am J Respir Crit Care Med 2008, 178:332–338.
5. Decramer M, Celli B, Kesten S, Lystig T, Mehra S, Tashkin DP, for the UPLIFT
Investigators: Effect of tiotropium on outcomes in patients with moderate
chronic obstructive pulmonary disease (UPLIFT): a prespecified subgroup
analysis of a randomized controlled trial. Lancet 2009, 374:1171–1178.
6. Troosters T, Celli B, Lystig T, Kesten S, Mehra S, Tashkin DP, Decramer M;
Uplift Investigators: Tiotropium as a first maintenance drug in COPD:
secondary analysis of the UPLIFT trial. Eur Respir J 2010, 36:65–73.
7. Vestbo J, Edwards LD, Scanlon PD, Yates JC, Agusti A, Bakke P, Calverley PM,
Celli B, Coxson HO, Crim C, Lomas DA, MacNee W, Miller BE, Silverman EK,
Tal-Singer R, Wouters E, Rennard SI; ECLIPSE Investigators: Changes in forced
expiratory volume in 1 second over time in COPD. N Engl J Med 2011,
365:1184–1192.
8. Calverley PMA, Pauwels R, Vestbo J, Jones P, Pride N, Gulsvik A, Anderson J,
Maden C; TRial of Inhaled STeroidsANd long-acting beta2 agonists study
group: Combined salmeterol and fluticasone in the treatment of chronic
obstructive pulmonary disease: a randomized controlled trial. Lancet 2003,
361:449–456.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
Calverley PMA, Anderson JA, Celli B, Ferguson GT, Jenkins C, Jones PW, Yates
JC, Vestbo J; TORCH investigators: Salmeterol and fluticasone propionate
and survival in chronic obstructive pulmonary disease. N Engl J Med 2007,
356:775–789.
Tashkin DP, Celli B, Senn S, Burkhart D, Kesten S, Menjoge S, Decramer M;
UPLIFT Study Investigators: A 4-year trial of tiotropium in chronic
obstructive pulmonary disease. N Engl J Med 2008, 359:1543–1554.
Jenkins CR, Jones PW, Calverley PM, Celli B, Anderson JA, Ferguson GT, Yates
JC, Willits LR, Vestbo J: Efficacy of salmeterol/fluticasone propionate by
GOLD stage of chronic obstructive pulmonary disease: analysis from the
randomized, placebo-controlled TORCH study. Respir Res 2009, 10:59–68.
Wedzicha JA, Calverley PMA, Seemugal TA, Hagan G, Ansari Z, Stockley RA,
for the INSPIRE Investigators: The prevention of chronic obstructive
pulmonary disease exacerbations by salmeterol/fluticasone propionate or
tiotropium bromide. Am J Respir Crit Care Med 2008, 177:19–26.
Kardos P, Wencker M, Glaab T, Vogelmeier C: Impact of salmeterol/
fluticasone propionate versus salmeterol on exacerbations in severe
chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2007,
175:144–149.
Vogelmeier C, Hederer B, Glaab T, Schmidt H, Rutten-van Mölken MP, Beeh
KM, Rabe KF, Fabbri LM; POET-COPD Investigators: Tiotropium versus
salmeterol for the prevention of exacerbations of COPD. N Eng J Med
2011, 364:1093–1103.
Decramer M, Chapman KR, Dahl R, Frith P, Devouassoux G, Fritscher C,
Cameron R, Shoaib M, Lawrence D, Young D, McBryan D; INVIGORATE
investigators: Once-daily indacaterol versus tiotropium for patients with
severe chronic obstructive pulmonary disease (INVIGORATE): a
randomised, blinded, parallel-group study. LancetRespir Med 2013,
1(7):524–533.
Wedzicha JA: Choice of bronchodilator therapy for patients with COPD.
N Engl J Med 2011, 364:1167–1168.
Wise RA, Anzueto A, Cotton D, Dahl R, Devins T, Disse B, Dusser D, Joseph E,
Kattenbeck S, Koenen-Bergmann M, Pledger G, Calverley P; TIOSPIR
Investigators: Tiotropium Respimat inhaler and the risk of death in COPD.
N Eng J Med 2013, 369:1491–1501.
Kerwin E, Hébert J, Gallagher N, Martin C, Overend T, Alagappan VK, Lu Y,
Banerji D: Efficacy and safety of NVA237 versus placebo and tiotropium in
patients with COPD: the GLOW2 study. Eur Respir J 2012, 40:1106–1114.
Aaron SD, Vandemheen KL, Fergusson D, Maltais F, Bourbeau J, Goldstein R,
Balter M, O’Donnell D, McIvor A, Sharma S, Bishop G, Anthony J, Cowie R,
Field S, Hirsch A, Hernandez P, Rivington R, Road J, Hoffstein V, Hodder R,
Marciniuk D, McCormack D, Fox G, Cox G, Prins HB, Ford G, Bleskie D,
Doucette S, Mayers I, Chapman K, et al: Tiotropium in combination with
placebo, salmeterol, or fluticasone-salmeterol for treatment of chronic
obstructive pulmonary disease. A randomized trial. Ann Intern Med 2007,
146:545–555.
Short PM, Williamson PA, Elder DHJ, Lipworth SI, Schembri S, Lipworth BJ:
The impact of tiotropium on mortality and exacerbations when added to
inhaled corticosteroids and long-acting β-agonist therapy in COPD. Chest
2012, 141:81–86.
Camicilotti G, Bigazzi F, Paoletti M, Cestelli L, Lavorini F, Pistolesi M:
Pulmonary function and sputum characteristics predict CT phenotype
and severity of COPD. Eur Respir J 2013, 42:626–635.
Ofir D, Laveneziana P, Webb KA, Lam YM, O’Donnel DE: Mechanisms of
dyspnea during cycle exercise in symptomatic patients with GOLD stage I
chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2008,
177:622–629.
O’Donnell DE, Laveneziana P, Ora J, Webb KA, Lam YM, Ofir D: Evaluation of
acute bronchodilator reversibility in patients with symptoms of GOLD
stage I COPD. Thorax 2009, 64:216–223.
Tashkin DP, Fabbri LM: Long-acting beta-agonists in the management of
chronic obstructive pulmonary disease: current and future agents. Respir
Res 2010, 11:149.
Rossi A, Khirani S, Cazzola M: Long-acting β2-agonist (LABA) in chronic
obstructive pulmonary disease: efficacy and safety. Int J COPD 2008, 3:521–529.
Jones PW, Donohue JF, Nedelman J, Pascoe S, Pinaul G, Lassen C:
Correlating changes in lung function with patient outcomes in
chronic obstructive pulmonary disease: a pooled analysis. Respir Res
2011, 12:161.
Dahl R, Greefhorst LA, Nowak D, Nonikov V, Byrne AM, Thomson MH, Till D,
Della Cioppa G; Formoterol in Chronic Obstructive Pulmonary Disease I
Page 13 of 16
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
Study Group: Inhaled formoterol dry powder versus ipratropium bromide
in chronic obstructive pulmonary disease study group. Am J Respir Crit
Care Med 2001, 164:778–784.
Rossi A, Kristufek P, Levine BE, Thomson MH, Till D, Kottakis J, Della Cioppa G;
Formoterol in Chronic Obstructive Pulmonary Disease (FICOPD) II Study
Group: Comparison of the efficacy, tolerability, and safety of formoterol
dry powder and oral, slow release theophylline in the treatment of COPD.
Chest 2002, 121:1058–1069.
Rossi A, Polese G: Indacaterol: a comprehensive review. Int J COPD 2013,
8:353–363.
Jones P, Singh D, Bateman ED, Agusti A, Lamarca R, de Miquel G, Segarra R,
Caracta C, Garcia Gil E: Efficacy and safety of aclidinium bromide
administered twice a day in patients with COPD; the ATTAIN study. Eur
Respir J 2012, 40:830–836.
Cazzola M, Page CP, Matera MG: Aclidinium bromide for the treatment of
chronic obstructive pulmonary disease. ExpOpinPharmacother 2013,
14:1205–1214.
Beier J, Kirsten AM, Mroz R, Segarra R, Chuecos F, Caracta C, Gil EG: Efficacy
and safety of aclidinium bromide compared with placebo and tiotropium
in patients with moderate-to-severe chronic obstructive pulmonary
disease: results from a 6-week, randomized, controlled phase IIIb study.
COPD 2013, 10:511–522.
Buhl R, Banerji D: Prophile of Glycopyrronium for once-daily treatment of
moderate-to-severe COPD. Int J COPD 2012, 2:729–741.
COMBIVENT Inhalation Aerosol Study Group: In chronic obstructive
pulmonary disease, a combination of ipratropium and alburerol is more
effective than either agent alone. An 85-day multicenter trial. Chest 1994,
105:1411–1419.
Benayoun S, Ernst P, Suissa S: The impact of combined inhaled
bronchodilator therapy in the treatment of COPD. Chest 2001, 119:85–92.
van Noord JA, Aumann JL, Janssens E, Verhaert J, Smeets JJ, Mueller A,
Cornelissen PJ: Effects of tiotropium with and without formoterol on
airflow obstruction and resting hyperinflation in patients with COPD.
Chest 2006, 129:509–517.
Rabe KF, Timmer W, Sagkriotis A, Viel K: Comparison of a combination of
tiotropium plus formoterol to salmeterol plus fluticasone in moderate
COPD. Chest 2008, 134:255–262.
van Noord JA, Buhl R, Laforce C, Martin C, Jones F, Dolker M, Overend T:
QVA149 demonstrates superior bronchodilation compared with
indacaterol or placebo in patients with chronic obstructive pulmonary
disease. Thorax 2010, 65:1086–1091.
Karner C, Cates CJ: Long-acting beta2-agonist in addition to tiotropium
versus either tiotropium or long-acting beta2-agonist alone for chronic
obstructive pulmonary disease. Cochrane Database Syst Rev 2012, 4, CD008989.
Mahler DA, D’Urzo A, Bateman ED, Ozkan SA, White T, Peckitt C, Lassen C, Kramer
B; INTRUST-1 and INTRUST-2 study investigators: Concurrent use of indacaterol
plus tiotropium in patients with COPD provides superior bronchodilation
compared with tiotropium alone: a randomized, double-blind comparison.
Thorax 2012, 67:781–788.
Tashkin DP, Ferguson GT: Combination bronchodilator in the management
of chronic obstructive pulmonary disease. Respir Res 2013, 14:49.
Vogelmeier CF, Bateman ED, Pallante J, Alagappan VK, D’Andrea P, Chen H,
Banerji D: Efficacy and safety of once-daily QVA149 compared with twicedaily salmeterol-fluticasone in patients with chronic obstructive
pulmonary disease (ILLUMINATE): a randomised, double-blind, parallel
group study. Lancet Respir Med 2013, 1:51–60.
Wedzicha JA, Decramer M, Ficker JH, Niewoehner DE, Sandström T, Taylor
AF, D’Andrea P, Arrasate C, Chen H, Banerji D: Analysis of chronic
obstructive pulmonary disease exacerbations with the dual
bronchodilator QVA149 compared with glycopyrronium and tiotropium
(SPARK): a randomised, double-blind, parallel-group study. Lancet Respir
Med 2013, 1:199–209.
Bateman ED, Ferguson GT, Barnes N, Gallagher N, Green Y, Henley M, Banerji
D: Dual bronchodilation with QVA149 versus single bronchodilator
therapy: the SHINE study. Eur Respir J 2013, 42:1484–1494.
Hurst JR, Vestbo J, Anzueto A, Locantore N, Müllerova H, Tal-Singer R, Miller
B, Lomas DA, Agusti A, Macnee W, Calverley P, Rennard S, Wouters EF,
Wedzicha JA; Evaluation of COPD Longitudinally to Identify Predictive
Surrogate Endpoints (ECLIPSE) Investigators: Susceptibility to exacerbation
in chronic obstructive pulmonary disease. N Engl J Med 2010,
363:1128–1138.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
46. Szafranski W, Cukier A, Ramirez A, Menga G, Sansores R, Nahabedian S,
Peterson S, Olsson H: Efficacy and safety of budesonide/formoterol in the
management of chronic obstructive pulmonary disease. Eur Respir J 2003,
21:74–81.
47. Calverley PM, Boonsawat W, Cseke Z, Zhong N, Peterson S, Olsson H:
Maintenance therapy with budesonide and formoterol in chronic
obstructive pulmonary disease. Eur Respir J 2003, 22:912–919.
48. Short PM, Williamson PA, Elder DH, Lipworth SI, Schembri S, Lipworth BJ: The
impact of tiotropium on mortality and exacerbations when added to
inhaled corticosteroids and long-acting - agonist therapy in COPD. Chest
2012, 141:81–86.
49. Welte T, Miravitlles M, Hernandez P, Eriksson G, Peterson S, Polanowski T,
Kessler R: Efficacy and tolerability of budesonide/formoterol added to
tiotropium in patients with chronic obstructive pulmonary disease. Am J
Respir Crit Care Med 2009, 180:741–750.
50. Rabe KF, Bateman ED, O’Donnell D, Witte S, Bredenbröker D, Bethke TD:
Roflumilast –an oral anti-inflammatory treatment for chronic obstructive
pulmonary disease: a randomized controlled trial. Lancet 2005,
366:563–571.
51. Calverley PMA, Sanchez-Toril F, Mclvor A, Teichmann P, Bredenbröker D,
Fabbri LM: Effect of 1-year treatment with roflumilast in severe chronic
obstructive pulmonary disease. Am J Respir Crit Care Med 2007,
176:154–161.
52. Calverley PMA, Rabe KF, Goehring U-M, Kristiansen S, Fabbri LM, Martinez F-J,
for the M2-124 and M2-125 study groups: Roflumilast in symptomatic
chronic obstructive pulmonary disease: two randomised clinical trials.
Lancet 2009, 374:685–694.
53. Fabbri LM, Calverley PM, Izquierdo-Alonso JL, Bundschuh DS, Brose M,
Martinez FJ, Rabe KF; M2-127 and M2-128 study groups: Roflumilast in
moderate-to-severe chronic obstructive pulmonary disease treated with
long acting bronchodilators: two randomised clinical trials. Lancet 2009,
374:695–703.
54. Beghè B, Rabe KF, Fabbri LM: Phosphodiesterase-4 inhibitor therapy for
lung diseases. Am J Respir Crit Care Med 2013, 188:271–278.
55. Celli BR, Cote CG, Marin JM, Casanova C, Montes de Oca M, Mendez RA,
Pinto Plata V, Cabral HJ: The body-mass index, airflow obstruction,
dyspnea, and exercise capacity index in chronic obstructive pulmonary
disease. N Engl J Med 2004, 350:1005–1012.
56. Celli BR, Calverley PM, Rennard SI, Wouters EF, Agusti A, Anthonisen N,
Macnee W, Jones P, Pride N, Rodriguez-Roisin R, Rossi A, Wanner A: Proposal
for a multidimensional staging system for chronic obstructive pulmonary
disease. Respir Med 2005, 99:1546–1554.
57. Funk GC, Kirchheiner K, Burghuber OC, Hartl S: BODE index versus GOLD
classification for explaining anxious and depressive symptoms in patients
with COPD – a cross-sectional study. Respir Res 2009, 10:1.
58. Jones RC, Donaldson GC, Chavannes NH, Kida K, Dickson-Spillmann M,
Harding S, Wedzicha JA, Price D, Hyland ME: Derivation and validation of a
composite index of severity in chronic obstructive pulmonary diseases.
Am J Respir Crit Care Med 2009, 180:1189–1195.
59. Puhan MA, Garcia-Aymerich J, Frey M, terRiet G, Antó JM, Agustí AG, Gómez
FP, Rodríguez-Roisín R, Moons KG, Kessels AG, Held U: Expansion of the prognostic assessment of patients with chronic obstructive pulmonary disease:
the updated BODE index and the ADO index. Lancet 2009, 374:704–711.
60. Rossi A, Zanardi E: E pluribus plurima: Multidimensional indices and
clinical phenotypes in COPD. Respir Res 2011, 12:15.
References regarding paragraph “Oxygen and non-pharmacological therapy”
1. Long term domiciliary oxygen therapy in chronic hypoxic corpulmonale
complicating chronic bronchitis and emphysema. Report of the Medical
Research Council Working Party. Lancet 1981, 1:681–686.
2. Nocturnal Oxygen Therapy Trial Group: Continuous or nocturnal oxygen
therapy in hypoxemic chronic obstructive lung disease: a clinical trial. Ann
Intern Med 1980, 93:391–398.
3. Plant PK, Owen JL, Elliott MW: One year period prevalence study of
respiratory acidosis in acute exacerbations of COPD: implications for the
provision of non-invasive ventilation and oxygen administration. Thorax
2000, 55:550–554.
4. Corrado A, Renda T, Bertini S: Long-Term Oxygen Therapy in COPD:
evidences and open questions of current indications. MonaldiArchChestDis
2010, 73:34–43.
5. Linee Guida “Insufficienza Respiratoria” Regione Toscana. 2010.
Page 14 of 16
6.
7.
8.
9.
10.
11.
Linee Guida per la Ossigenoterapia a lungo termine (OTLT).
Aggiornamento anno 2004. Rassegna di Patologia dell’Apparato Respiratorio
2004, 19:206–219.
Guyatt GH, Nonoyama M, Lacchetti C, Goeree R, McKim D, Heels-Ansdell D,
Goldstein R: A randomized trial of strategies for assessing eligibility for
long-term domiciliary oxygen therapy. Am J Respir Crit Care Med 2005,
172:573–580.
Clini E, Sturani C, Rossi A, Viaggi S, Corrado A, Donner CF, Ambrosino N;
Rehabilitation and Chronic Care Study Group, Italian Association of Hospital
Pulmonologists (AIPO): The Italian multicentre study on noninvasive ventilation
in chronic obstructive pulmonary disease patients. Eur Respir J 2002, 20:529–538.
Criner GJ: Lung volume reduction as an alternative to transplantation for
COPD. Clin Chest Med 2011, 32:379–397.
Garrity ER, Moore J, Mulligan MS, Shearon TH, Zucker MJ, Murray S: Heart
and lung transplantation in the United States, 1996–2005. Am J Transplant
2007, 7:1390–1403.
Cai J: Double- and single-lung transplantation: an analysis of twenty years
of OPTIN/UNOS registry data. ClinTranspl 2007:1–8.
Guidelines: General bibliography regarding paragraph “Rehabilitation”
Guidelines
ACCP/AACVPR: Pulmonary rehabilitation. Joint ACCP/AACVPR evidence-based
clinical practice guidelines. Chest 2007, 131:4–42.
ATS/ERS Task Force: Standards for the Diagnosis and Treatment of Patients with
COPD. 2004. available on line, www.ers-education.org.
British Thoracic Society: Guidelines for the physiotherapy management of the
adult medical, spontaneously breathing patients. Thorax 2009, 64(suppl):1–51.
British Thoracic Society: Pulmonary rehabilitation. Thorax 2001, 56:827–834.
Statements – Consensus – Position Papers
Ambrosino N, Vitacca M, Rampulla C: Percorsi riabilitativi nelle malattie
respiratorie. Fondazione Maugeri IRCCS “I Documenti” 1997, (n°11).
Nici L, Donner C, Wouters E, Zuwallack R, Ambrosino N, Bourbeau J, Carone M, Celli
B, Engelen M, Fahy B, Garvey C, Goldstein R, Gosselink R, Lareau S, MacIntyre N,
Maltais F, Morgan M, O’Donnell D, Prefault C, Reardon J, Rochester C, Schols A,
Singh S, Troosters T; ATS/ERS Pulmonary Rehabilitation Writing Committee:
American Thoracic Society/European Respiratory Society: Statement on
pulmonary rehabilitation. Am J Respir Crit Care Med 2006, 173:1390–1413.
Associazione Italiana Pneumologi Ospedalieri: Raccomandazioni sulla
Riabilitazione Respiratoria. RassPatol App Respir 2007, 22:264–288.
European Society of Intensive Care Medicine: Physiotherapy for adult patients
with critical illness: recommendations of ERS and ESICM Task Force on
Physiotherapy for critically ill patients. Intensive Care Medicine 2008,
34:1188–1199.
California pulmonary Rehabilitation Collaborative Group: Effects of pulmonary
rehabilitation on dyspnea, quality of life, and healthcare costs in
California. J CardiopulmRehabil 2004, 24:52–62.
Revisions – Meta-analyses
Casaburi R, ZuWallack R: Pulmonary rehabilitation for management of chronic
obstructive pulmonary disease. N Engl J Med 2009, 360:1329–1335.
Nici L, Raskin J, Rochester CL, Bourbeau JC, Carlin BW, Casaburi R, Celli BR, Cote C,
Crouch RH, Diez-Morales LF, Donner CF, Fahy BF, Garvey C, Goldstein R,
Lane-Reticker A, Lareau SC, Make B, Maltais F, McCormick J, Morgan MD, Ries
A, Troosters T, ZuWallack R: Pulmonary rehabilitation: what we know and
what we need to know. J CardiopulmRehabilPrev 2009, 29:141–151.
Lacasse Y, Goldstein R, Lasserson TJ, Martin S: Pulmonary rehabilitation for chronic
obstructive pulmonary disease. Cochrane Database Syst Rev 2006, 4, CD003793.
Puhan M, Scharplatz M, Troosters T, Walters EH, Steurer J: Pulmonary
rehabilitation following exacerbations of chronic obstructive pulmonary
disease. Cochrane Database Syst Rev 2009, 1, CD005305.
Troosters T, Casaburi R, Gosselink R, Decramer M: Pulmonary rehabilitation in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med 2005, 172:19–38.
Troosters T, Gosselink R, Janssens W, Decramer M: Exercise training and
pulmonary rehabilitation: new insights and remaining challenges. Eur
Respir Rev 2010, 19(115):24–29.
References regarding paragraph “Exacerbations”
1. Hurst JR, Vestbo J, Anzueto A, Locantore N, Müllerova H, Tal-Singer R, Miller B,
Lomas DA, Agusti A, Macnee W, Calverley P, Rennard S, Wouters EF,
Wedzicha JA; Evaluation of COPD Longitudinally to Identify Predictive Surrogate
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Endpoints (ECLIPSE) Investigators: Susceptibility to exacerbation in chronic
obstructive pulmonary disease. N Engl J Med 2010, 363:1128–1138.
Trappenburg JCA, van Deventer AC, Troosters T, Verheij TJ, Schrijvers AJ,
Lammers JW, Monninkhof EM: The impact of using different symptombased exacerbation algorithms in patients with COPD. Eur Respir J 2011,
37:1260–1268.
Mackay AL, Donaldson GC, Patel ARC, Jones PW, Hurst JR, Wedzicha JA:
Usefulness of the chronic obstructive pulmonary disease assessment test
to evaluate severity of COPD exacerbations. Am J Respir Crit Care Med 2012,
185:1218–1224.
Seemugal TAR, Donaldson GC, Bhowmik A, Jeffries DJ, Wedzicha JA: Time
course and recovery of exacerbations in patients with chronic obstructive
pulmonary disease. Am J Respir Crit Care Med 2000, 161:1608–1613.
Donaldson GC, Seemugal TAR, Bhowmik A, Wedzicha A: Relationship
between exacerbation frequency and lung function decline in chronic
obstructive pulmonary disease. Thorax 2002, 57:847–852.
Anzueto A, Leimer I, Kesten S: Impact of frequency of COPD exacerbations
on pulmonary function, health status and clinical outcomes. Int J COPD
2009, 4:245–251.
Tillie-Leblond I, Marquette CH, Perez T, Scherpereel A, Zanetti C, Tonnel AB,
Remy-Jardin M: Pulmonary embolism in patients with unexplained
exacerbation of chronic obstructive pulmonary disease: prevalence and
risk factors. Ann Intern Med 2006, 144:390–396.
Rizkallah J, Man SFP, Sin DD: Prevalence of pulmonary embolism in acute
exacerbations of COPD. A systematic review and meta-analysis. Chest
2009, 135:786–793.
Papi A, Bellettato CM, Braccioni F, Romagnoli M, Casolari P, Caramori G,
Fabbri LM, Johnston SL: Infections and airway inflammation in chronic
obstructive pulmonary disease severe exacerbations. Am J Respir Crit Care
Med 2006, 173:1114–1121.
Di Marco F, Verga M, Santus P, Morelli N, Cazzola M, Centanni S: Effect of
formoteroltiotropium and their combination in patients with acute
exacerbation of chronic obstructive pulmonary disease. A pilot study.
Respir Med 2006, 100:1925–1932.
Albert RK, Martin TR, Lewis SW: Controlled clinical trial on
methylprednisolone in patients with chronic bronchitis and acute
respiratory insufficiency. Ann Intern Med 1980, 92:753–758.
Davies L, Angus RM, Calverley PM: Oral corticosteroids in patients admitted
to hospital with exacerbations of chronic obstructive pulmonary disease:
a prospective randomized controlled trial. Lancet 1999, 354:456–460.
Niewoehner DE, Erbland ML, Deupree RH, Collins D, Gross NJ, Light RW,
Anderson P, Morgan NA: Effect of systemic glucocorticoids on
exacerbations of chronic obstructive pulmonary disease. Department of
Veterans Affairs Cooperative Study Group. N Engl J Med 1999,
340:1941–1947.
Anthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK, Nelson
NA: Antibiotic therapy in exacerbations of chronic obstructive pulmonary
disease. Ann Intern Med 1987, 106:196–204.
Saint S, Bent S, Vittinghoff E, Grady D: Antibiotics in chronic obstructive
pulmonary disease exacerbations. A meta-analysis. JAMA 1995,
273:957–960.
Stockley RA, O’Brien C, Pye A, Hill SL: Relationship of sputum color to
nature and outpatient management of acute exacerbations of COPD.
Chest 2000, 117:1638–1645.
Roede BM, Bresser P, Prins JM, Schellevis F, Verheij TJ, Bindels PJ: Reduced
risk of next exacerbation and mortality associated with antibiotic use in
COPD. Eur Respir J 2009, 33:282–288.
Daniels JMA, Snijders D, de Graaff CS, Vlaspolder F, Jansen HM, Boersma WJ:
Antibiotics in addition to systemic corticosteroids for acute exacerbations
of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2012,
181:150–157.
Celli BR, MacNee W, and committee members: Standards for the diagnosis
and treatment of patients with COPD: a summary of the ATS/ERS position
paper. Eur Respir J 2004, 23:932–946.
Siafakas NM, Vermeire P, Pride NB, Paoletti P, Gibson J, Howard P, Yernault
JC, Decramer M, Higenbottam T, Postma DS, et al: Optimal assessment and
management of chronic obstructive pulmonary disease. ERS, consensus
statement. Eur Respir J 1995, 8:1398–1420.
O’Donnell DE, Aaron S, Bourbeau J, Hernandez P, Marciniuk DD, Balter M,
Ford G, Gervais A, Goldstein R, Hodder R, Kaplan A, Keenan S, Lacasse Y,
Maltais F, Road J, Rocker G, Sin D, Sinuff T, Voduc N: Canadian Thoracic
Page 15 of 16
Society recommendation for management of chronic obstructive
pulmonary disease - 2007 update. Can Respir J 2007, 14:5b–32b.
22. Nava S, Fanfulla F: Ventilazione meccanica non invasiva. Come, quando e
perché. Milano: Springer-Verlag Italia; 2010.
References regarding paragraph “Integrated hospital-community management
of patients with severe COPD”
1. Statement ATS: Standards for the diagnosis and care of patients with
chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1995,
5:S77–S120.
2. ATS ERS statement. Eur Respir J 2004, 23:932–946.
3. Corrado A, Roussus C, Ambrosino N, Confalonieri M, Cuvelier A, Elliott M,
Ferrer M, Gorini M, Gurkan O, Muir JF, Quareni L, Robert D, Rodenstein D,
Rossi A, Schoenhofer B, Simonds AK, Strom K, Torres A, Zakynthinos S;
European Respiratory Society Task Force on epidemiology of respiratory
intermediate care in Europe: Respiratory intermediate care units: an
European survey. Eur Respir J 2002, 20:1343–1350.
4. Corrado A, Ambrosino N, Cavalli A, Sturani C: Unità di terapia intensiva
respiratoria: update. RassPatAppRespir 2004, 19:18–34.
5. Linee Guida “Insufficienza Respiratoria” Regione Toscana.2010.
6. Statement on Home Care for Patients with Respiratory Disorders: This official
statement of the American Thoracic Society was approved by the ATS
board of Directors December 2005. Am J Respir Crit Care Med 2005,
171:1443–1464.
7. Farrero E, Escarrabill J, Prats E, Maderal M, Manresa E: Impact of a hospitalbased home-care program on the management of COPD patients
receiving long-term oxygen therapy. Chest 2001, 119:364–369.
8. Hermiz O, Comino E, Marks G, Daffurn K, Wilson S, Harris M: Randomised
controlled trial of home based care of patients with chronic obstructive
pulmonary disease. BMJ 2002, 325:938–940.
9. Lanken PN, Terry PB, Delisser HM, Fahy BF, Hansen-Flaschen J, Heffner JE,
Levy M, Mularski RA, Osborne ML, Prendergast TJ, Rocker G, Sibbald WJ,
Wilfond B, Yankaskas JR; ATS End-of-Life Care Task Force: An official
American Thoracic Society clinical policy statement: palliative care for
patients with respiratory diseases and critical illnesses. Am J Respir Crit Care
Med 2008, 177:912–927.
10. Curtis JR: Palliative and end of life care for patients with severe COPD. Eur
Respir J 2008, 32:796–803.
11. Cure palliative dei pazienti con patologie respiratorie croniche avanzate
non oncologiche. 2011. Position Paper AIPO-SIAARTI-ARIR.
12. D.M. del MURST 20/4/90.
13. Piano Sanitario Nazionale 2011–2013. www.salute.gov.it
General bibliography regarding paragraph “Integrated hospital-community
management of patients with severe COPD”
Jaana M, Paré G, Sicotte C: Home telemonitoring for respiratory conditions: a
systematic review. Am J Manag Care 2009, 15:313–320.
Linee Guida “Insufficienza Respiratoria” Regione Toscana. 2010.
Statement ATS: Standards for the diagnosis and care of patients with chronic
obstructive pulmonary disease. Am J Respir Crit Care Med 1995,
5:S77–S121.
Statement on Home Care for Patients with Respiratory Disorders: This official
statement of the American Thoracic Society was approved by the ATS
board of Directors December 2005. Am J Respir Crit Care Med 2005,
171:1443–1464.
Corrado A, Roussus C, Ambrosino N, Confalonieri M, Cuvelier A, Elliott M, Ferrer
M, Gorini M, Gurkan O, Muir JF, Quareni L, Robert D, Rodenstein D, Rossi A,
Schoenhofer B, Simonds AK, Strom K, Torres A, Zakynthinos S; European
Respiratory Society Task Force on epidemiology of respiratory intermediate
care in Europe: Respiratory intermediate care units: an European survey.
EurRespir J 2002, 20:1343–1350.
Farrero E, Escarrabill J, Prats E, Maderal M, Manresa F: Impact of a hospital-based
home-care program on the management of COPD patients receiving
long-term oxygen therapy. Chest 2001, 119:364–369.
Hermiz O, Comino E, Marks G, Daffurn K, Wilson S, Harris M: Randomised
controlled trial of homebased care of patients with chronic obstructive
pulmonary disease. BMJ 2002, 325:938–940.
Jaana M, Paré G, Sicotte C: Home telemonitoring for respiratory conditions: a
systematic review. Am J Manag Care 2009, 15:313–320.
Dal Negro RW, Goldberg AI (Eds): Home Long-Term Oxygen Treatment in Italy. The
Additional Value of Telemedicine”. Berlin Heidelberg. Springer Publ; 2005:71–85.
Bettoncelli et al. Multidisciplinary Respiratory Medicine 2014, 9:25
http://www.mrmjournal.com/content/9/1/25
Page 16 of 16
Vitacca M, Mazzù M, Scalvini S: Socio-technical and organizational challenges
to wider e-Health implementation. ChronRespir Dis 2009, 6:91.
Vitacca M, Bianchi L, Guerra A, Fracchia C, Spanevello A, Balbi B, Scalvini S:
Tele-assistance in chronic respiratory failure patients: a randomised
clinical trial. Eur Respir J 2009, 33:411–418.
Vitacca M, Comini L, Tentorio M,Assoni G, Trainini D, Fiorenza D, Morini R, Bruletti
G, Scalvini S:A pilot trial of telemedicine-assisted, integrated care for
patients with advanced amyotrophic lateralsclerosis and their caregivers.
J TelemedTelecare 2010, 16:83–88.
Piano Sanitario Nazionale 2011–2013.
D.M. del MURST 20/4/90.
References regarding paragraph “Palliative and end of life care in COPD”
Lanken PN, Terry PB, Delisser HM, Fahy BF, Hansen-Flaschen J, Heffner JE, Levy M,
Mularski RA, Osborne ML, Prendergast TJ, Rocker G, Sibbald WJ, Wilfond B,
Yankaskas JR; ATS End-of-Life Care Task Force: An official American Thoracic
Society clinical policy statement: palliative care for patients with
respiratory diseases and critical illnesses. Am J Respir Crit Care Med 2008,
177:912–927.
Curtis JR: Palliative and end of life care for patients with severe COPD. Eur
Respir J 2008, 32:796–803.
Cure palliative dei pazienti con patologie respiratorie croniche avanzate non
oncologiche. 2011. Position Paper AIPO-SIAARTI-ARIR.
GOLD Global Initiative for Chronic Obstructive Lung Disease: Global Strategy for
the Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary
Disease. Updated 2011.
Centre NCG: Chronic Obstructive Pulmonary Disease: Management of Chronic
Obstructive Pulmonary Disease in Adults in Primary and Secondary Care.
London: National Clinical Guideline Centre; 2010. Available from: http://
guidance.nice.org.uk/CG101/Guidance/pdf/English.
Celli B, MacNee W, and committee members: Standards for the diagnosis and
treatment of patients with COPD: a summary of the ATS/ERS position
paper. Eur Respir J 2004, 23:932–946.
Brusasco V, Crapo R, Viegi G; American Thoracic Society; European Respiratory
Society: Coming together: the ATS/ERS consensus on clinical pulmonary
function testing. Eur Respir J 2005, 26:1–2. 153–161; 319–338; 511–522;
720–735; 948–968.
Screening for chronic obstructive pulmonary disease using spirometry: U.S.
preventive services task force recommendation statement. Ann Intern Med
2008, 148:529–534.
Qaseem A, Wilt TJ, Weiberger SE, Hanania NA, Criner G, van der Molen T,
Marciniuk DD, Denberg T, Schünemann H, Wedzicha W, MacDonald R,
Shekelle P; American College of Physicians; American College of Chest
Physicians; American Thoracic Society; European Respiratory Society:
Diagnosis and management of stable chronic obstructive pulmonary
disease: a clinical practice guideline from the ACP, ACCP, ATS and ERS.
Ann Intern Med 2011, 155:179–191.
doi:10.1186/2049-6958-9-25
Cite this article as: Bettoncelli et al.: The clinical and integrated management
of COPD. An official document of AIMAR (Interdisciplinary Association for
Research in Lung Disease), AIPO (Italian Association of Hospital
Pulmonologists), SIMER (Italian Society of Respiratory Medicine), SIMG (Italian
Society of General Medicine). Multidisciplinary Respiratory Medicine 2014 9:25.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
ORIGINAL RESEARCH ARTICLE
Open Access
Predictors of seasonal influenza vaccination in
chronic asthma
Rachelle Asciak*, Martin Balzan and Jesmar Buttigieg
Abstract
Background: Guidelines advise annual influenza vaccination in chronic asthma. The aim of this study was to
determine uptake of the influenza vaccine in a group of patients (n = 146) with moderate to severe chronic asthma
and establish the main predictors of vaccination.
Method: Patients attending a hospital asthma clinic were asked to complete a questionnaire in February 2012 (n = 146).
These same patients were contacted a year later via telephone (n = 109 responded), and they were asked to
complete the same questionnaire.
Results: Vaccination rate was 50.3% in winter 2011/12, and 57.8% in 2012/13. Using binary logistic regression, the
predictors for vaccination in 2012 were patient advice (Odds ratio [OR] 15.37 p = 0.001), female gender (OR 2.75,
p = 0.028), past side effects (OR 0.21, p = 0.001) and comorbidity (OR 0.39, p = 0.013). Stepwise regression resulted
in age as predictor (T value = 3.99, p = 0.001). On analyzing the responses from the second questionnaire at one
year after attendance to asthma clinic, predictors changed to compliance to medication (OR 9.52, p= 0.001) and
previous exacerbations (OR 4.19, p = 0.026). Out of the 56 patients vaccinated in 2011/12, 33 reported asthma
exacerbations before 2012, and 29 reported asthma exacerbations after receiving the influenza vaccine. Out of the
46 unvaccinated patients in 2012, 27 had asthma exacerbations before 2012 and 19 patients had exacerbations in
2013. Patients vaccinated in 2011/12 needed 0.59 courses of steroid/patient/year, and 1.23 visits for nebulizer/
patient/year while non-vaccinated patients needed 0.18 courses of steroids/patient/year (p = 0.048), and 0.65 visits
for nebulized/patient/year (p = 0.012). Patients’ subjective statements broadly confirmed the predictors. 16/69
(23.1%) received the vaccine in winter 2012/13 despite reporting previous side effects.
Conclusions: Advice to patient, female gender and patients’ age predicted vaccination, while past side effects to
the influenza vaccine, and presence of comorbidities predicted non vaccination. Symptomatic asthma patients are
more likely to be vaccinated. One year after the first contact, treatment compliance and previous asthma
exacerbations gained statistical significance as predictors of vaccination.
Keywords: Asthma, Influenza, Vaccine
Background
Evidence shows that influenza vaccination leads to decreased hospitalization from influenza complications, fewer
deaths during the influenza season, decreased healthcare
costs in the elderly in the general population [1], and a decreased number of lost workdays and physician visits in
healthy adults [2]. Asthma patients are considered to be at
increased risk of influenza complications, however there is
conflicting evidence on the beneficial effect of influenza
* Correspondence: [email protected]
Department of Medicine, Mater Dei Hospital, 211, Street Margaret Street Tal
Qroqq, Msida MSD 2090, Malta
vaccination on asthma exacerbations. Some studies suggest
that, at least in children, the vaccine decreases asthma exacerbations [3], however in adults, a meta-analysis of published studies has failed to demonstrate a significant
decrease in asthma exacerbations [4].
Despite this lack of evidence, the Global Initiative for
Asthma (GINA) guidelines issued in December 2011, advise that patients with moderate to severe asthma should
receive influenza vaccination every year or at least when
vaccination of the general population is advised. The
British Thoracic Society (BTS) guidelines on asthma
2008, revised in June 2009, also advise administration of
© 2013 Asciak et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
the influenza vaccine independent of any considerations
related to asthma. The Advisory Committee on Immunization Practices (ACIP) recommends annual influenza
vaccination for adults and children with chronic disorders of the pulmonary or cardiovascular systems, including asthma.
This study was performed at Mater Dei Hospital, the
University hospital of Malta (population c. 411,277). At
this hospital the asthma clinics are run by Consultant Respiratory physicians, who together with specialist trainees
in respiratory medicine and general medicine, see to patients attending these clinics. The clinics are run with the
help of a nurse. Many asthma patients are followed up in
the community, however most of the more severe cases
are referred to the asthma clinic for follow up.
The aim of this study was to determine the uptake of
the influenza vaccine in a group of patients with moderate
to severe chronic asthma and to try to establish the main
predictors of vaccination.
Method
Between 17th January and 18th February 2012, adult patients with chronic asthma attending a hospital asthma
clinic were asked to fill in a standardized questionnaire,
with a Maltese and English version available according
to patients’ preference. Data collected included age, gender, asthma control, whether patients had been advised
to receive the influenza vaccine or not, and if so by
whom. Questions included information on previous vaccination and side effects to the vaccine, whether the patient had received the vaccine this year or not, and the
reasons behind his/her decision. Patients were also asked
about comorbidities such as chronic kidney disease, for
which guidelines also advise influenza vaccination. Asthma
control was assessed by frequency of salbutamol use or
reliever medication, the need for systemic steroids or
nebulized treatment, and hospitalization over the past
12 months. After patients had filled in the questionnaire, participants received advice on the importance of
influenza vaccination in asthma patients.
The following year, in February 2013, the same patients
were contacted by telephone and the same questionnaire
was used, in order to follow up and compare results with
the previous year. At least two attempts were made to
contact each patient.
Patients were considered to have well-controlled asthma
if they rarely or never required their reliever salbutamol
inhaler, and did not need hospitalization, oral steroids or
nebulized treatment over the previous year. They were
considered to have poorly controlled asthma if they used
salbutamol several times daily and/or needed hospitalization, oral steroids and nebulized treatment during the previous year.
Page 2 of 6
Compliance was assessed by asking patients how often
they forgot to take their medication. Those who never or
rarely forgot to take their asthma treatment were defined
as compliant, while patients who forgot to take their
treatment more than once a week or on a daily basis
were defined as being non-compliant. Patients with incomplete questionnaires were excluded from the study.
Statistical analysis
The data collected was analyzed using Microsoft Office
Access® and Excel®. Categorical data was summarized
using percentages, and Fisher’s two-tailed exact test was
used for categorical values. Binary logistic regression
and Stepwise regression was determined using Minitab
16 software. P <0.05 was considered to be statistically
significant.
Consent
Authorization to perform this study was obtained from
the hospital’s data protection officer. Data protection
approval was deemed sufficient from an ethical point of
view. Consent was obtained from all the Consultant
Respiratory physicians in the hospital to interview
asthma patients under their care. Consent to perform
the questionnaires was obtained from all patients.
Results
A total of 146 patients (103 females, 43 males, mean age
47.9 years SD 19.3) suffering from chronic asthma were
studied. Out of these patients, 80 individuals (63 females
and 17 males) received the influenza vaccine during the
winter of 2011/12. This is a 50.3% vaccination rate after
correcting for gender.
109 patients (78 female, 31 male; mean age 53.6, SD 18.0)
responded to the second questionnaire the following year,
and vaccination rate rose to 57.8% (M 45.2%, F 70.5%)
after correcting for gender.
Table 1 shows the characteristics of the original 146
patients by gender. The mean age for those taking the
vaccine was 55.06 years, while the mean age for those not
taking the vaccine was 42.77 years (p = 0.0002). 86.2% of
the patients had been advised to take the vaccine. 62.4% of
the patients who were advised to take the vaccine were
vaccinated in winter 2011/12, while only 10% of those not
advised were vaccinated that winter (p = <0.0001).
In Table 2, binary logistic regression and stepwise regression show patient advice and female gender as predictors for taking the vaccine, while comorbidity and a
history of previous side effects to the vaccine are shown
to be the main negative predictors for vaccination. Figure 1
shows the reasons asthma patients gave for taking the influenza vaccine that winter. Figure 2 shows the reasons
given by the patients for not taking the vaccine (patients
were given the option of choosing more than one reason).
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
Page 3 of 6
Table 1 Characteristics of patients by gender in the
2011/12 questionnaire
Descriptor
Male
(n= 43)
Female
(n= 103)
Mean age
47.95
50.41
Years of asthma
Averaged
rate
18.34
15.44
Life-time non-smokers
65.12%
79.61%
72.36%
Ex smoker
27.91%
16.50%
22.21%
Current smoker
6.98%
3.88%
5.43%
41.86%
42.57%
42.22%
Reliever use
Never
≤ twice weekly
6.98%
9.90%
8.44%
> twice weekly
4.65%
19.80%
12.23%
Once daily
16.28%
8.91%
12.59%
> once daily
30.23%
18.81%
24.52%
Compliant to preventer therapy
80.95%
73.74%
77.34%
Exacerbations previous year
Exacerbation occurrence
51.16%
59.22%
55.19%
Nebulizer therapy
34.88%
43.69%
39.29%
Oral steroid administration
32.56%
35.92%
34.24%
Hospitalization for asthma
13.95%
14.56%
14.26%
Intensive care admission
0.00%
2.91%
1.46%
Comorbidity
26.19%
30.30%
28.25%
Hypertension
23.26%
27.18%
25.22%
Diabetes
11.63%
10.68%
11.15%
Ischaemic heart disease
4.65%
2.91%
3.78%
Chronic kidney disease
2.33%
0.97%
1.65%
Table 2 Binary logistic regression and stepwise
regression of possible factors predicting vaccination for
influenza in 2011/12 (n=146)
Predictor (binary logistic regression)
p
Odds ratio
95% CI
Advised to take vaccine
0.001
15.37
2.98 79.13
Female gender
0.028
2.75
1.11
6.8
Compliance to medication
0.278
1.69
0.65
4.37
Exacerbations in previous year
0.294
1.61
0.66
3.9
Patient age
0.01
1.05
1.02
1.08
Asthma years
0.265
1.02
0.99
1.05
Frequency of reliever use
0.263
0.86
0.65
1.12
Comorbidity (0–4)
0.013
0.39
0.19
0.82
Previous side effects
0.001
0.21
0.08
0.53
Stepwise regression
p
T value
0.001
4.15
Previous side effects
0.001
−3.54
Patient age
0.001
3.99
Comorbidity (0–4)
0.021
−2.34
Female gender
0.021
2.34
Advised to take vaccine
With regard to the 2012/13 period, 92 out of 109
(84.4%) patients who responded to the questionnaire in
2013 reported previous vaccination, 78 (71.6%) had received the vaccine at least once over the previous two
years, while 51 (46.8%) received the vaccine in both
years. 18 out of the 109 patients (17%) received the vaccine in winter 2012/13 but not in 2011/12. On the other
hand 9/109 patients did not revaccinate in 2012/13. Predictors of vaccination in 2012/13 using logistic and stepwise regression are listed in Table 3 (102 patients with
complete data utilized).
According to the 51 patients who received the vaccine
in both years, the reasons for re-vaccination in 2012/13
were doctor’s advice (66.7%), to protect themselves (39.2%),
to protect family (13.7%), and to prevent asthma exacerbations (47.1%). The reasons given for vaccination in
2012/13 by patients who had not received the influenza
vaccine the previous year (n = 18) were physician advice
17 (93.5%,p = 0.002), to protect themselves - 5 (27.8%),
to protect family 1 (5.6%), and to prevent asthma exacerbations 4 (22.2%, p = 0.039).
31 patients (28.4%) did not receive the influenza vaccine
in either year. Out of these, 22 (71.0%) said this was because of fear of vaccine side effects. On the other hand,
there were 7 patients who had received the vaccine in winter 2011/12, but not in 2012/13, and the reasons given
were fear of vaccine side effects (2), patients forgot to take
the vaccine (4), and patients did not feel the need to take
the vaccine (1).
13 out of 51 (25.5%) patients vaccinated in both years,
and 16 out of 69 (23.1%) patients vaccinated in 2012/13
had received the influenza vaccine in the second consecutive year despite reporting previous side effects to the
vaccine.
Asthma reliever medication use amongst patients vaccinated in 2012/13, n = 69, (no information available on
two subjects), showed that 20 (29.0%) used short-acting
beta agonist daily or more frequently, 19 (27.5%) used it
2-6 times per week, and 30 (43.5%) never used it. For
non vaccinated patients in 2012/13 (n = 40) data was
17.5%, 22.5%, 60.0%, respectively (p = 0.22).
33 (58.9%) out of 56 patients vaccinated in 2011/12 reported asthma exacerbations in the year preceding vaccination, and 29 reported exacerbations in the year following
vaccination, while out of 46 unvaccinated patients, 27 reported exacerbations in the year prior to vaccination compared to 19 in the following year.
Patients vaccinated in 2011/12 needed 0.59 courses of
systemic steroids/patient/year, and 1.23 visits for nebulizer/
patient/year in the following year. Non vaccinated patients
needed 0.18 courses of systemic steroids/patient/year
(p = 0.048), and 0.65 visits for nebulizer/patient/year
(p = 0.012) respectively. Unfortunately data prior to vaccination was not available.
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
Page 4 of 6
Figure 1 Reasons asthma patients gave for taking influenza vaccine in winter 2011/12.
Discussion
This study showed that despite the recommendation for
influenza vaccination in asthma guidelines, just under
half of the patients with asthma failed to take the influenza vaccine. The decision whether to take it or not is
influenced by several factors including trust or mistrust
in modern medicine, perceived side-effects from prior
vaccination, perceived risk associated with influenza [5],
and concern that vaccination may induce exacerbations
of asthma. A randomized controlled trial (RCT) involving 2,032 adults with asthma [6], and a large multicentre
cohort study [7] concluded that influenza vaccination in
asthma is safe.
In our study, the reported influenza vaccination rate of
57.8% was encouraging when compared to the 39.9% for
adult asthmatic patients in 2006-2007 in the USA [8],
and 40% vaccination rate in asthma patients in 2003 in a
single urban British general practice in Exeter [9].
This study was carried out on patients attending a hospital asthma clinic; therefore patients were likely to suffer
from more severe asthma compared to patients treated in
primary care. In fact, 55.19% reported exacerbations in the
previous year, and 77.34% reported to be prescribed and
to be compliant with preventer medication.
The power of this study was insufficient to gauge the
impact of vaccination as there was an insignificant difference in exacerbation rates before and after vaccination for
individual vaccinated patients. However, there was a significantly higher asthma exacerbation rate in vaccinated
patients when compared to unvaccinated patients. Though
not reaching statistical significance, non-vaccinated patients
seemed to use more short-acting reliever medication. This
could reflect the possibility that patients with more severe
symptoms are more likely to vaccinate against influenza.
On the contrary, it is also possible that those patients with
less severe or more intermittent asthma are less likely to
Figure 2 Reasons given by patients for not taking influenza vaccine in winter.
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
Page 5 of 6
Table 3 Odds ratio for predictors of vaccination in 2012/13
(n = 102)
Binary logistic regression
p
Odds ratio
Compliance to medication
0.001
9.52
2.42
95% CI
37.5
Exacerbation in last year
0.018
4.8
1.31
17.6
Female gender
0.026
4.19
1.19
14.77
Advised to vaccinate
0.124
3.22
0.72
14.31
Frequency of reliever use
0.125
1.35
0.92
1.97
Age
0.017
1.05
1.01
1.09
Number of years asthma
0.232
0.98
0.94
1.02
Comorbidity (0–4)
0.575
0.66
0.16
2.81
Previous side effects
0.001
0.08
0.02
0.3
Stepwise regression
p
T Value
Compliance to medication
0.001
3.4
Previous side effects
0.001
−4.14
Exacerbation past year
0.011
2.6
Age
0.021
2.34
Female gender
0.022
2.33
vaccinate. Furthermore, perhaps more reliance on reliever
medication reflected a different behavioural attitude which
was not otherwise assessed in this study.
Unvaccinated patients reported a lower number of exacerbations in the second year. This was probably the result of new attendants to the asthma clinic who besides
being offered vaccination could have their asthma better
controlled with medication. While this reason is speculative, this explanation is supported by the emergence of
compliance to medication and the occurrence of previous exacerbations as a predictor for vaccination after
one year of attendance to the asthma clinic.
Using binary logistic regression in the first questionnaire, advice to the patient, and patient gender were the
best predictors of vaccination, while presence of comorbidities and having experienced previous vaccine side
effects were the negative predictors.
The effect of gender on vaccination rates in the general
population varies significantly between countries [10], and
in July 2010 a publication by the World Health Organization
in entitled ‘Sex, gender and influenza’ states that the severity
of asthma tends to be worse in women than in men, and
women are more likely than men to be caregivers. Because
of this, it is possible that women could be more aware of
influenza risk and the necessity to vaccinate themselves.
Other factors have been shown to affect influenza vaccination in asthma, including increased vaccination rates with
age [11]. In this study while the mean age of vaccinated
patients was higher than in non-vaccinated patients, logistic
regression failed to show it as a predictor, while stepwise
regression re-instated it. This may have occurred because
the stepwise regression model used only 5 statistically
significant predictors out of the 9 predictors evaluated, removing the possible confounders of age. Logistic regression
had evaluated all the 9 predictors.
In the first questionnaire, receiving advice to vaccinate
heavily predicted influenza vaccination, but this effect
was greatly decreased in the second questionnaire as
probably many patients with a mindset not to vaccinate
had also received advice during the first questionnaire,
thus leveling off the difference between vaccinated and
non vaccinated individuals. However, one year after attendance to the asthma clinic the second questionnaire
produced two new predictors, namely: compliance to
medication and occurrence of previous exacerbations.
This indicates that overall, patients at the asthma clinic
were not only advised to receive the influenza vaccine,
but their asthma treatment was also optimized.
18 patients who were vaccinated in 2012/13 and not in
2011/12 nearly unanimously stated that advice was crucial
in their decision making, especially doctors’ advice. Indeed
all patients on direct questioning highly rated the impact of
physician advice on their decision to vaccinate. Medical literature confirms that physician recommendations and education about influenza vaccine availability, effectiveness, and
adverse effects [12] were other factors which were found to
influence parents to vaccinate their asthmatic children.
Both logistic regression and stepwise regression showed
that the most consistent negative predictor was the occurrence of past side effects to the influenza vaccine.
This was confirmed as the main reason for not vaccinating by the patients’ responses to direct questioning.
Notwithstanding this, a significant proportion of patients do actually vaccinate despite having experienced
previous vaccine side effects. This may reflect that side
effects are often minor when compared to the fear of
major attacks of acute asthma. This reason is supported
by the fact there was a greater likelihood for severely affected patients to vaccinate.
Public Health vaccination campaigns tend to target
mainly the elderly population, who are more likely to
suffer from comorbidities. However in this study despite
the fact that 28% of patients had comorbidities, logistic
and stepwise regression gave a negative predictive value.
The study cannot offer an explanation for this result, except that this may be a possible reason for an increased
fear of side effects of vaccination.
The main limitations of the study were that information
on whether the patient had been vaccinated or not during
the previous 12 months was obtained by self-report. The
statistical power was too low to give an indication of the
potential benefit of vaccination on the control of asthma
symptoms. Furthermore, the hospital environment might
have influenced respondents to praise the effect of medical advice and perhaps overestimate their compliance to
medication.
Asciak et al. Multidisciplinary Respiratory Medicine 2013, 8:68
http://www.mrmjournal.com/content/8/1/68
Conclusions
Advice by a medical practitioner or health care professional, female gender of patients, and increasing patient
age resulted in a higher vaccination rate. Fear of sideeffects and the presence of comorbidities were negative
predictors of vaccination. While this study could not assess the effectiveness of the vaccine in preventing severe
attacks, patients with more severe symptoms are more
likely to vaccinate against influenza. One year after the
first questionnaire, compliance to medication and occurrence of a previous exacerbation became a positive predictor of vaccination. Around a fourth of patients with
asthma still vaccinate against influenza despite the previous occurrence of side effects.
Page 6 of 6
10. Endrich MM, Blank PR, Szucs TD: Influenza vaccination uptake and
socioeconomic determinants in 11 European countries. Vaccine 2009,
27(30):4018–4024.
11. Ford ES, Mannino DM, Williams SG: Asthma and influenza vaccination.
Findings from the 1999–2001 national health interview surveys.
Chest 2003, 124(3):783–789.
12. Gnanasekaran SK, Finkelstein JA, Hohman K, O’Brien M, Kuskal B, Lieu T:
Parental perspectives on influenza vaccination among children with
asthma. Public Health Rep 2006, 121(2):181–188.
doi:10.1186/2049-6958-8-68
Cite this article as: Asciak et al.: Predictors of seasonal influenza
vaccination in chronic asthma. Multidisciplinary Respiratory Medicine
2013 8:68.
Competing interest
The authors declare that they have no competing interest.
Authors’ contributions
RA study design, obtaining consent from Consultant physicians and hospital
data protection office, data collection, inputting and analysis, drafting and
revision of manuscript. JB Data inputting and data analysis. MB study design,
supervision of the study, data analysis, statistics, drafting and revision of
manuscript. All authors read and approved the final manuscript.
Acknowledgements
Nursing staff at medical outpatients who helped distribute the
questionnaires to patients attending asthma clinic. Dr L Mercieca, Dr C
Zammit, Dr J Camilleri who collected data over both years, and input data in
the database. Dr D Bilocca and Dr P Fsadni who collected data.
Received: 5 June 2013 Accepted: 27 August 2013
Published: 21 October 2013
References
1. Nichol KL, Margolis KL, Wuorenma J, Von Sternberg T: The efficacy and
cost effectiveness of vaccination against influenza among elderly
persons living in the community. N Engl J Med 1994, 331:778–784.
2. Bridges CB, Thompson WW, Meltzer MI, Reeve GR, Talamonti WJ, Cox NJ,
Lilac HA, Hall H, Klimov A, Fukada K: Effectiveness and cost-benefit of
influenza vaccination of healthy working adults, a randomized
controlled trial. JAMA 2000, 284(13):1655–1663.
3. Kramartz P, Destefano F, Gargiullo PM, Chen RT, Lieu TA, Davis RL, Mullooly
JP, Black SB, Shinefield HR, Bohlke K, Ward JI, Marcy SM: Vaccine safety
Datalink team: does influenza vaccination prevent asthma exacerbations
in children. J Paediatr 2001, 138(3):306–310.
4. Cates CJ, Jefferson TO, Bara AI, Rowe BH: Vaccines for preventing influenza
in people with asthma. Cochrane Database Syst Rev 2008:CD000364.
5. Telford R, Rogers A: What influences elderly peoples’ decisions about
whether to accept the influenza vaccination? A qualitative study, health
education research. Educ Res 2003, 18(6):743–753.
6. The American lung association asthma clinical research centres: The safety
of inactivated influenza vaccine in adults and children with asthma.
N Engl J Med 2001, 345:1529–1536.
7. Kramarz P, DeStefano F, Gargiullo PM, Davis RL, Chen RT, Mullooly JP, Black SB,
Shinefield HR, Bohlke K, Ward JI, Marcy MS: Does influenza vaccination
exacerbate asthma? Analysis of a large cohort of children with asthma.
Vaccine safety datalink team. Arch Fam Med 2000, 9:617–623.
8. Lu PJ, Euler GL, Callahan DB: Influenza vaccination among adults with
asthma. Findings from the 2007 behavioural risk factor surveillance
system (BRFSS) survey. Am J Prev Med 2009, 37(2):109–115.
9. Keenan H, Campbell J, Evans PH: Influenza vaccination in patients with
asthma: why is the uptake so low? Br J Gen Pract 2007, 57(538):359–363.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
ORIGINAL RESEARCH ARTICLE
Open Access
Value of serum and induced sputum surfactant
protein-D in chronic obstructive pulmonary
disease
Berna Akinci Ozyurek1, Sevinc Sarinc Ulasli2*, Serife Savas Bozbas3, Nilufer Bayraktar4 and Sule Akcay3
Abstract
Background: Surfactant Protein D (SP-D) is an important marker in chronic obstructive pulmonary disease (COPD).
Serum SP-D levels increase while lung production of SP-D decreases in COPD. SP-D is a specific biomarker for
monitoring COPD, assessment of exacerbation frequency and arrangement of treatment modalities. In the present
study, we aimed to investigate the correlation between serum and induced sputum SP-D levels with severity and
acute exacerbations of COPD.
Method: 20 healthy subjects, older than 40 years, with at least 10 pack/years smoking history (group 1), 20 stage I-II
COPD patients (group 2) , and 20 stage III-IV COPD patients (group 3) were enrolled in the study. All subjects
performed pulmonary function tests. Venous blood samples were taken to determine complete blood count,
C-reactive protein(CRP) and serum SP-D levels. Induced sputum samples were obtained to determine SP-D level.
COPD patients were followed up for acute exacerbations for 6 months.
Results: Serum SP-D levels of group 3 were the highest and induced sputum SP-D levels of group 2 were the
lowest among the three groups. SP-D levels of induced sputum decreased in patients with increasing number of
cigarette pack/years (p = 0.03, r = −0.115), whereas serum SP-D levels increased in these patients (p = 0.0001, r = 0.6 ).
Induced sputum SP-D levels in COPD patients receiving inhaled corticosteroid treatment were significantly higher
than in patients who were not receiving inhaler corticosteroid treatment (p = 0.005). An inverse correlation between
serum SP-D levels and FEV1 (%) was found and there was a positive correlation between the serum SP-D levels and
exacerbations frequency in 6-month follow up period (p = 0.049 ,r = −0.252; p = 0.0001, r = 0.598 respectively).
Conclusion: Our study demonstrates the adverse effects of smoking on local SP-D levels since low levels of
induced sputum SP-D were found in the group of current smokers, who were not receiving inhaled corticosteroid
treatment. Relationship between serum SP-D and COPD exacerbations frequency suggests that serum SP-D level
may be used as a lung-specific biomarker during the follow up and progression of COPD.
Keywords: Chronic obstructive pulmonary disease, Induced sputum, Surfactant protein-D
Background
Chronic obstructive pulmonary disease (COPD) is a
complex chronic inflammatory disease that involves the
activity of various inflammatory cells and mediators [1].
Both local and systemic inflammatory reactions are observed in COPD. There are ongoing researches trying to
find out different markers in COPD course. For instance,
* Correspondence: [email protected]
2
Department of Pulmonary Diseases, Afyon Kocatepe University Faculty of
Medicine, Afyon, Turkey
Full list of author information is available at the end of the article
surfactant protein D (SP-D) is one of the most frequently studied markers contributing to immune and
inflammatory regulation within lungs. SP-D is a 43kDa
member of the collectin family that is produced from
collagenous glycoprotein in type II pneumocytecells. SPD is a protein responsible for homeostasis which has an
important protective role in the immune system against
inhaled microorganisms and allergens. It plays a part in
protection against viral, bacterial, and fungal infections,
as well as apoptotic cells [2]. Serum SP-D concentration
exhibits an increase together with the decrease in
© 2013 Akinci Ozyurek et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
bronchoalveolar lavage in COPD. Furthermore, serum
SP-D level and FEV1 display a negative correlation in
COPD [3]. Higher serum SP-D levels have been found
[3] in advanced COPD cases with worsening health and
aggravating shortness of breath. SP-D is thought to play
a role in the pathogenesis and progression of COPD [4].
SP-D level declines as the disease progresses. There are
also some studies indicating the increase of BAL SP-D
level using inhaled corticosteroids. The association between decreased SP-D level in lungs and smoking has
also been demonstrated in previous studies [5,6]. Therefore, SP-D is a promising biomarker that might help to
determine the health status of patients with lung diseases, particularly with respect to progression of dyspnea
and decreasing pulmonary functions.
SP-D of serum and BAL or induced sputum may be
used as a lung specific biomarker in the assessment of
COPD progression and management. The number of
studies investigating the relationship between local and
systemic SP-D levels with COPD is not as high as it
should be. Therefore, in the present study we aim to
investigate the relationships between COPD severity and
acute exacerbations frequency with serum and induced
sputum SP-D levels.
Methods
This study was approved by the Research Committee
of the Medical Faculty and Health Sciences, Baskent
University (project# KA09/277) and supported by the
Research Fund of Baskent University. Written informed consent was obtained from each participating
patient and control subjects prior to the study.
Our study sample comprised of 60 subjects in total: a
control group including 20 individuals (16 smokers and
4 ex-smokers) above 40 years of age (mean age: 44.85 ±
5.80 years) and with a history of at least 10 pack year
cigarette consumption (mean cigarette pack year: 23 ±
13 pack year) (Group 1), 20 mild and moderate COPD
patients (Group 2), and 20 severe and very severe COPD
patients (Group 3) based on GOLD classification [7].
The patients below 40 years of age and those with a
history of COPD exacerbation/infection within the last 4
weeks, cardiac disease, chronic liver and kidney failure,
asthma, malignancy, hypertension, diabetes mellitus, and
any additional medical disorders were excluded from the
study.
In our study all patients and control subjects performed
pulmonary function tests (PFT). Furthermore, venous
blood sample was collected from each participant for evaluating complete blood count (CBC), C-reactive protein
(CRP), and serum SP-D level. Induced sputum specimen
was obtained and also tested for induced sputum SP-D
level. COPD patients were followed for 6 months to determine exacerbation frequency. Acute exacerbation of COPD
Page 2 of 7
was defined as a sustained (lasting 48 hours or more) worsening of dyspnea, cough or sputum production leading to
an increase in the use of maintenance medications and/or
supplementation with additional medications [7,8]. The
data concerning the exacerbation frequency were collected
via hospital visits and telephone calls.
Measurement of biochemical parameters
Venous blood sample was obtained from each patient. 3
ml venous peripheral blood specimen was put into a
tube with K3-EDTA for CBC and 5 ml venous peripheral
blood specimen was put into an additive-free tube for
analysis of CRP and SP-D levels. Serum samples were
prepared by collecting blood in a vacuum tube and
allowing it to clot for 30 minutes at room temperature.
About 1mL of serum was obtained after centrifugation
at 1100g for 10 minutes and stored in small aliquots
at −80°C until analysis. SP-D level was studied by
ELISA immunoassay method. Serum CRP level was
measured by an ultrasensitive latex-enhanced immunoassay method, using CRP Ultra reagent (Sentinel Diagnostics, Milan, Italy) in Abbott Architect C8000 Analyzer
according to the manufacturer’s specifications. The detection limit was 0.2 mg/L. The inter- and intra-assay variability were 8.22% and 4.84%, respectively. CBC was
carried out with Abbott Cell-Dyne® 3700 System device
(Abbott Diagnostics, Santa Clara, CA, USA).
Pulmonary function test
Pulmonary function test was performed with a clinical
spirometer (SensorMedicsVmax spectra 229, Bilthoven,
The Netherlands) according to the ERS standards [9].
We carried out forced vital capacity (FVC) and forced
expiratory volume (FEV1) measurements, and calculated
the FEV1/FVC ratio. Total lung capacity (TLC), residual
volume (RV), functional residual capacity (FRC), and
vital capacity (VC) were measured by the multiple nitrogen washout method. Twenty healthy individuals having
normal PFTs and 40 patients diagnosed as mild, moderate, severe, and very severe COPD based on the current
Global Initiative for Chronic Obstructive Lung Disease
(GOLD) guidelines using postbroncodilatator FEV1
values (post bronchodilator values were obtained after
400 mcg salbutamol inhalation), were enrolled in the
study [7].
Induced sputum analysis
The patients were informed about the process and FEV1
values were measured before the bronchodilatation.
Then, 10 minutes after inhaling 400 μg salbutamol, postbronchodilatator FEV1 values were measured. Induction
was started with 3% NaCl in patients with FEV1 value
>1 L or >60%. This was continued for a period up to
20 minutes by incremental doses applied with
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
nebulizer at 5 minute intervals and FEV1 values were
measured after each induction. If 20% or more decrease
in FEV1 values was detected, process was terminated.
The induction started using 0.9% NaCL with nebulizer
in patients with a FEV1 value <1 L or <60%. The induction was carried out for 30 seconds, 1 minute, and 5 minutes. At the end of these time intervals, FEV1 value was
re-measured and induction was discontinued if there
was a decrease of 20% or more. Induction with higher
concentration was not applied to patients when adequate material could be obtained at this concentration.
If the patient failed to produce sputum and/or adequate
sputum at these concentrations, induction was applied
using 3% NaCl with nebulizer and it was carried out for
30 seconds, 1 minute, and 2 minutes. At the end of these
time intervals, FEV1 value was measured again and induction was discontinued if there was a decrease of 20%
or more. Induction with a higher concentration was not
applied to patients when adequate material could be
obtained at this concentration. If the patient failed to
produce sputum and/or adequate sputum at this concentration, induction was applied with 4.5% NaCl and it
was carried out for 30 seconds, 1 minute, 2 minutes, and
4 minutes. At the end of these times, FEV1 value was
measured again and induction was discontinued if there
was a decrease of 20% or more. Following each induction, participants were asked to rinse their mouth with
water and produce sputum by cough.
The processing of induced sputum
The induced sputum was immediately analyzed following
the acquirement. Firstly, the specimen was weighed. Sputum was treated with Sputalysin (0.1% DTT) by mixing the
agent in a 1:1 ratio with the specimen. The mixture was
vortexed for 15 minutes at room temperature and thereafter it was filtered through a 48μm-thick nylon filter. The
resulting filtrate was weighed. The cell viability of the
filtrate was evaluated by Trypan blue and total cell count
(TCC) was calculated on a Thoma slide. TCC was calculated by following the formula: Average number of cells in
one large square x dilution factor* x 104 (*dilution factor is
2x2 = 4 (1:1 dilution with Sputalysin and 1:1 dilution with
trypan blue)). The filtrate (790μg) was centrifuged at 4°C
for 10 minutes. The resultant supernatant was separated and put into Falcon tubes. These tubes were
stored at −20°C.
Induced sputum and serum SP-D level determination
Surfactant protein D concentration in serum and induced sputum samples was determined by a sandwich
enzyme-linked immunosorbent assay (ELISA) system
(SP-D; Biovendor, Brno, Czech Republic). For SP-D, the
inter- and intraassay CV were 3.7% and 2.3%, respectively, and the sensitivity was 0.01 ng/ml.
Page 3 of 7
Statistical analysis
The statistical analyses of our study were performed using
SPSS statistical software version 15.0. The variables were
investigated using visual (histograms, probability plots) and
analytical methods (Kolmogorov-Simirnov test) to determine the normality of distributions. The results were
expressed as mean ± standard deviation and median value.
For continuous variables without normal distribution
Mann–Whitney U test was used for the comparison of the
two groups (patients receiving inhaler steroids or not receiving inhaler steroids), whereas Kruskal-Wallis test for
the comparison of parameters between 3 groups. T- test
was used for the comparison of parameters with normal
distribution between 2 groups and ANOVA together with
Bonferroni correction was used for the comparison of continuous parameters with normal distribution among the
three groups. The parameters affecting 6 month exacerbation frequency, induced sputum and serum surfactant protein D levels were investigated using Spearman correlation
analysis. Multiple linear regression models were used to
identify independent predictors of 6 month exacerbation
frequency, serum and induced sputum surfactant protein
D levels. The model fit was assessed using appropriate
residual and goodness of fit statistics. A 5% type-I error
level was used to infer statistical significance.
Results
The demographic characteristics, PFT parameters and
complete blood count results of our study groups are
reported in Table 1. CRP levels of group I were the lowest among study groups (p = 0.03).
Smoking status (active, ex-smoker) of the groups was
also evaluated. 80% of the healthy individuals (n = 16) in
Group 1, 50% of patients (n = 10) in Group 2, and 10% of
patients (n = 2) in Group 3 were active smokers. The
amount of cigarette consumption (pack/years) was 20
pack/years in Group 1, 45 pack/years in Group 2, and 45
pack/years in Group 3. When we asked the ongoing
bronchodilatator and/or oxygen therapy of COPD patients,
24 patients were found to be on inhaled corticosteroid
therapy and 12 patients on nasal oxygen therapy due to
type I respiratory failure (Table 2). Mean duration of inhaled steroid treatment was 5.31 ± 3.81 years.
The serum and sputum SP-D values of subjects in all
three groups were compared (Table 3). Serum SP-D levels
of Group 3 were the highest and serum SP-D levels of
Group 2 were higher than Group 1. However, there was no
statistically significant difference among the three groups in
terms of serum SP-D level (p = 0.099). In addition, we did
not find statistically significant difference among the three
groups in terms of induced sputum SP-D levels (p = 0.836).
Although, induced sputum SP-D levels in Group 2 were
the lowest, they did not achieve to the significance level.
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
Page 4 of 7
Table 1 Demographic characteristics and respiratory function test results of the study population
Group 1 (control subjects)
Group 2 (stage 1 and
2 COPD patients)
Group 3 (stage 3 and
4 COPD patients)
(n = 20)
(n = 20)
(n = 20)
P
Mean Age (year)
44.85 ± 5.80
60.35 ± 9.40
63.70 ± 8.60
p = 0.001
Gender (F/M)
8/12
0/20
3/17
p = 0.004
33.36 ± 5.70
32.8 ± 6.70
29.6 ± 5.90
p = 0.148
p = 0.001
2
Mean BMI (kg/m )
Smoking status
Active smokers
16 (80%)
10 (50%)
2 (10%)
Ex-smokers
4 (20%)
10 (50%)
18 (90%)
Cigarette pack years
23 ± 13 (20)
51 ± 28 (45)
51 ± 33(45)
p = 0.001
Inhaled steroid use
0
6
18
p = 0.001
Mean FVC (%)
131.5 ± 15.1
101.7 ± 19
76.7 ± 16.8
p = 0.001
Mean FEV1 (%)
123 ± 14
75.7 ± 16.4
39.7 ± 7.24
p = 0.001
Mean FEV1/FVC (%)
78.9 ± 4.8
59.75 ± 10.8
43.3 ± 11.3
p = 0.001
Mean FEF25-75 (%)
94.5 ± 23.4
33.5 ± 18.6
12.5 ± 4.54
p = 0.001
Mean VC (%)
130 ± 16.9
94.5 ± 19
80.8 ± 19
p = 0.001
Mean RV (%)
120 ± 29
156 ± 37
150 ± 77
p = 0.001
Mean SpO2 (%)
96.6 ± 1.1
94 ± 1.9
92.1 ± 2.1
p = 0.001
Mean CRP level (mg/L)
2.52 ± 2.4
8.3 ± 10
8.1 ± 9.49
p = 0.014
Mean Hb (g/dl)
14.21 ± 1.55
14.7 ± 1.43
14.6 ± 14
p = 0.282
Mean WBC (/μL)
7.449 ± 1.704
7.291 ± 1.084
8.402 ± 1.694
p = 0.102
Mean PMNL (/μL)
4.272 ± 1.166
4.310 ± 956
5.519 ± 1.205
p = 0.003
The results are expressed as mean ± standard deviation.
BMI Body mass index, CRP C-reactive protein, FEV1 forced expiratory volume, FRC functional residual capacity, FVC forced vital capacity, Hb hemoglobin,
PMNL polymorphonucleer leukocyte, RV residual volume, TLC total lung capacity, VC vital capacity, WBC white blood cell count.
The groups were also evaluated in terms of relationships between cigarette consumption (pack year) and
serum/sputum SP-D levels. While sputum SP-D and
cigarette consumption demonstrated a negative correlation (p = 0.03, r = −0.115), serum SP-D and cigarette
consumption showed a positive correlation (p = 0.0001,
r = 0.6 ).No significant difference was observed between
genders in terms of serum/sputum SP-D levels and cell
viability.
Serum SP-D levels were significantly correlated with
FEV1 (%) (p = 0.049; r = −0.252). However no significant correlation was found between FEV1 (%) and induced sputum SP-D levels (p = 0.92, r = −0.013).
Induced sputum and serum SP-D levels were significantly
different between patients with and without inhaled corticosteroid therapy (p = 0.005 and 0.038 respectively). The
COPD patients receiving inhaled corticosteroid therapy had
higher SP-D levels compared to those not receiving inhaled
Table 2 Treatment modalities of COPD patients
Group 2 (stage 1 and 2 COPD patients)
Group 3 (stage 3 and 4 COPD patients)
(n = 20)
(n = 20)
Short acting β2 agonist
6
12
Long acting β2 agonist
12
18
Long acting anticholinergic
7
15
Inhaler steroid
6
18
N-acetyl systein
2
7
Long term oxygen therapy
2
10
Pulmoner rehabilitation
0
7
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
Page 5 of 7
Table 3 Comparison of SP-D levels and cell viability among the study groups
Group 1 (control subjects) Group 2 (stage 1 and 2 COPD patients) Group 3 (stage 3 and 4 COPD patients)
Serum SP-D (ng/ml)
(n = 20)
(n = 20)
(n = 20)
86.2 ± 49
108.9 ± 65
129 ± 71
p
p = 0.10
Sputum SP-D (ng/ml) 33.1 ± 34
28 ± 15.2
30.42 ± 12.8
p = 0.83
Viability %
79.8 ± 11.2
80.1 ± 19
p = 0.86
73.5 ± 12.1
The results were expressed as mean ± standard deviation.
COPD Chronic obstructive pulmonary disease, SP-D surfactant protein D.
corticosteroid therapy (Table 4). The Number of years on
inhaled steroid treatment was significantly correlated with
induced sputum SP-D levels whereas no significant correlation was evidenced with serum SP-D levels (p = 0.0001,
r = 0.800; p = 0.59, r = 0.104 respectively).
We also evaluated the relationships between serum/sputum SP-D levels and 6-month exacerbation frequency in
COPD patients of Groups 2 and 3. There was no significant correlation between sputum SP-D levels and 6-month
exacerbation frequency (p = 0.051; r = 0.342). However,
patients with increased serum SP-D levels had significantly higher 6-month exacerbation frequency (p = 0.0001;
r = 0.59). The other parameters such as BMI, cigarette
pack years, FEV1(%) and number of years on inhaled steroid treatment were not correlated with 6-month exacerbation frequency (p = 0.39, r = 0.152; p = 0.117 r = −0.278;
p = 0.177, r = −0.241; p = 0.137, r = 0.294 respectively).
Multiple linear regression analyses were conducted
after adjusting for age, cigarette pack years, BMI, FEV1
(L), FEV1(%), number of years on inhaled steroid treatment, serum and induced sputum SP-D levels; only
serum SP-D levels were found to be significantly associated with acute exacerbation frequency (p =0.0001).
Sputum surfactant protein D level was found to be significantly associated with number of years on inhaled
steroid treatment (p = 0.0001). Serum surfactant protein
D level was significantly related with 6 month exacerbation frequency (p = 0.0001) (Table 5).
Discussion
In this study, we investigated the relationships between
local and systemic SP-D levels, and course of COPD by
evaluating serum and induced sputum SP-D levels. In
the literature review, no study including both induced
sputum and serum SP-D measurement in COPD patients has been found according to our knowledge.
Induced sputum analysis has been recently recognized
as a valuable method for revealing the pathogenesis of
inflammatory airway diseases such as COPD and asthma,
and monitoring the activity and treatment response in
these pathologies [10-13]. Currently, induced sputum is
recognized to reflect lower respiratory tract inflammation
[10,13]. Therefore, we preferred to use induced sputum
specimens, also known as cost-effective diagnostic tool,
in evaluating the courses of local and systemic inflammation in COPD.
Previous studies have demonstrated a positive correlation between cigarette consumption (pack year) and
serum SP-D levels. Serum SP-D concentrations have
been found to be higher in current smokers than in exsmokers [2,14]. In our study, among COPD patients,
there was a negative correlation between induced sputum
SP-D levels and cigarette consumption (pack year),
whereas serum SP-D levels and cigarette consumption
(pack year) showed a positive correlation.
The comparison of induced sputum SP-D levels
among three groups revealed no statistically significant
difference. Sputum SP-D concentrations of Group 2
were lowest among study groups. Furthermore, 50% of
patients in Group 2 were currently active smokers. Inhaled corticosteroid treatment was more common in
Group 3 due to increased airway obstruction level and
exacerbation frequency of severe and very severe COPD
patients. Sputum SP-D levels were significantly different
between patients with and without inhaled corticosteroid
therapy in the present study. Moreover, significant correlation was also found between number of years on inhaled corticosteroid treatment and induced sputum SPD levels in linear regression analysis. These results also
support the fact that the use of inhaled corticosteroids
indirectly contributes to the local SP-D levels in a positive way [15]. Ishikawa et al. found increased induced
sputum SP-D levels in 28 COPD patients compared to
subjects with prolonged cough [16]. They included patients with mild, moderate and severe COPD patients,
and subjects with prolonged cough as control group and
Table 4 Comparison of patients with and without inhaled corticosteroid therapy
COPD patients receiving inhaled steroid (n = 24)
COPD patients not receiving inhaled steroid (n = 16)
p
Serum SP-D (ng/ml)
132 ± 71
99 ± 59
0.038
Sputum SP-D (ng/ml)
35.5 ± 14
20 ± 7.8
0.005
The results were expressed as mean ± standard deviation.
COPD Chronic obstructive pulmonary disease, SP-D surfactant protein D.
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
Page 6 of 7
Table 5 Multiple linear regression models
Multiple linear regression model for six month exacerbation frequency by serum and induced sputum SP-D levels
Coefficient B
Standard error
t
p
Constant
−0.37
0.32
−1.15
0.25
Serum SP-D levels
0.008
0.002
4.22
0.0001
Sputum SP-D levels
0.011
0.009
1.18
0.247
Multiple linear regression model for induced sputum SP-D levels by six month exacerbation frequency and number of years on inhaled steroid
treatment.
Coefficient B
Standard Error
t
p
Constant
16.948
3.78
4.4
0.0001
Six month exacerbation frequency
1.38
2.14
0.64
0.525
Number of years on inhaled steroid treatment
2.848
0.53
5.37
0.0001
Multiple linear regression model for serum SP-D levels by age, FEV1 (%) and six month exacerbation frequency
Constant
Coefficient B
Standard error
t
p
17.660
70.64
0.25
0.80
Age
1.461
1.08
1.35
0.187
FEV1(%)
−0.61
0.45
−1.36
0.182
Six month exacerbation frequency
42.598
9.85
4.32
0.0001
FEV1 forced expiratory volume, SP-D surfactant protein D.
did not mention the medications of the subjects. Different results might be due to the fact that study populations and medications in the study by Ishiwaka et al.
were different from those in present study.
In COPD patients, serum SP-D levels and FEV1 show
a negative correlation, whereas lung SP-D levels and
FEV1 exhibit a slightly positive correlation [3]. In the
present study, serum SP-D levels were negatively correlated with FEV1(%) and group 3 had the highest serum
SP-D levels among study groups. Group 2 had higher
serum SP-D levels than Group 1, although, these differences did not reach to significance level. We believe
that low number of patients in all groups was a limitation for the statistical comparison.
We had a higher number of males than females in study
groups (F/M:11/49). In a recent study COPD rate was
reported as four times higher in males than females in our
country and total smoking, biomass, and occupational exposure were also found to be overwhelmingly higher in
males than females (16.1% and 3.9% respectively) [17].
Therefore, these results could be attributed to a higher
incidence of COPD in males as higher incidence of smoking and environmental/occupational exposure in our
country.
Acute exacerbations that are observed during the
course of the COPD are significant causes of morbidity
and mortality [18,19]. Some COPD patients exhibit a
higher acute exacerbation frequency mostly due to the
infections of tracheobronchial tree. Some studies demonstrate that increased airway inflammation incidence
may have a role in the elevated acute exacerbation frequency [18]. Our patients were followed up for 6 months
for acute exacerbations. In 20 (50%) of our COPD patients
in group 2 or 3, the acute exacerbation frequency varied
between 1 and 3 within a 6 month follow-up period. 85%
of 20 patients with a history of exacerbation were moderate, severe, and very severe COPD cases. This finding is
consistent with the fact that raised airway inflammation
increases the frequency and number of acute
exacerbations.
In advanced COPD patients especially with frequent
acute exacerbations, markers of systemic inflammation
such as cytokines, chemokines, and acute phase proteins
have been used [18-20]. SP-D, has also been proposed to
be a lung-specific biomarker in COPD cases [21]. Elevated serum SP-D levels can show the poor health status
of COPD patients within a 3 month period [3]. Also
Shakoori TA et al. demonstrated in COPD patients
higher levels of serum SP-D levels during acute exacerbation than during stable period [22]. In our study, we
determined a significant relationship between serum SP-D
level and number of acute exacerbations within a 6 month
period. In addition, we strengthen our hypothesis in linear
regression analysis and found that the only significant
determinant of 6 month exacerbation frequency was
serum SP-D. These findings also suggest that SP-D level
may be a lung-specific biomarker that can be used for
monitoring COPD and its progression.
Limitations
The limitations of our study were the unequal number
of female and male patients, the absence of a nonsmoker healthy control group, and the failure to convince higher number of patients to participate in the
Akinci Ozyurek et al. Multidisciplinary Respiratory Medicine 2013, 8:36
http://www.mrmjournal.com/content/8/1/36
study. Further studies with larger sample sizes are
needed to confirm and explore the findings of the
present study.
Conclusions
In conclusion, we believe that our preliminary study demonstrates a significant relationship between serum SP-D
and COPD exacerbation frequency which suggests that
serum SP-D level may be used as a lung-specific biomarker during the follow-up and progression of COPD.
Competing interests
The authors declared that they have no competing interests.
Acknowledgement
Authors would like to thank Alper Murat Ulasli, MD, for his professional
support in the statistical analysis of the present study and Elif Erdem for her
technical assistance.
Author details
1
Ataturk Chest Diseases and Thoracic Surgery Training and Research Hospital,
Ankara, Turkey. 2Department of Pulmonary Diseases, Afyon Kocatepe
University Faculty of Medicine, Afyon, Turkey. 3Faculty of Medicine,
Department of Pulmonary Diseases, Baskent University, Ankara, Turkey.
4
Faculty of Medicine, Department of Biochemistry, Baskent University, Ankara,
Turkey.
Received: 15 September 2012 Accepted: 31 March 2013
Published: 1 June 2013
References
1. Barnes PJ, Celi BR: Systemic manifestations and comorbidities of COPD.
Eur Respir J 2009, 33:1165–1185.
2. Lomas DA, Silverman EK, Edwards LD, Locantore NW, Miller BE: Serum
surfactant protein D is steroid sensitive and associated with
exacerbations of COPD. Eur Respir J 2009, 34:95–102.
3. Sin DD, Leung R, Gan WQ, Man SP: Circulating surfactant protein D as a
potential lung-specific biomarker of health outcomes in COPD: a pilot
study. BMC Pulm Med 2007, 7:13.
4. Crouch EC: Surfactant protein-D and pulmonary host defense. Respir Res
2000, 1:93–108.
5. Honda Y, Kuroki Y, Matsuura E, Nagae H, Takahashi H, Akino T, Abe S:
Pulmonary surfactant protein D in sera and bronchoalveolar lavage
fluids. Am J Respir Crit Care Med 1995, 152(6 Pt1):1860–1866.
6. Betsuyaku T, Kuroki Y, Nagai K, Nasuhara Y, Nishimura M: Effects of ageing
and smoking on SP-A and SP-D levels in bronchoalveolar lavage fluid.
Eur Respir J 2004, 24(6):964–970.
7. From the Global Strategy for the Diagnosis, Management and Prevention of
COPD: Global Initiative for Chronic Obstructive Lung Disease (GOLD). 2011.
http://www.goldcopd.org/.
8. Anthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK, Nelson
NA: Antibiotic therapy in exacerbations of chronic obstructive
pulmonary disease. Ann Intern Med 1987, 106:196–204.
9. Miller MR, Hankinson J, Brusasco V, Burgos F, Casaburi R, Coates A, Crapo R,
Enright P, van der Grinten CP, Gustafsson P, Jensen R, Johnson DC,
MacIntyre N, McKay R, Navajas D, Pedersen OF, Pellegrino R, Viegi G,
Wanger J: ATS/ERS Task Force. Standardisation of spirometry. Eur Respir J
2005, 26(2):319–338.
10. Dar KA, Shahid M, Mubeen A, Bhargava R, Ahmad Z, Ahmad I, Islam N:
The role of noninvasive methods in assessing airway inflammation and
structural changes in asthma and COPD. Monaldi Arch Chest Dis 2012,
77(1):8–18.
11. Rytila PH, Lindqvist AE, Laitinen LA: Safety of sputum induction in chronic
obstructive pulmonary disease. Eur Respir J 2000, 15:1116–1119.
12. Vlachos-Mayer H, Leigh R, Sharon RF, Hussack P, Hargreave FE: Success and
safety of sputum induction in the clinical setting. Eur Respir J 2000,
16(5):997–1000.
Page 7 of 7
13. Hacievliyagil SS, Gunen H, Mutlu LC, Karabulut AB, Temel I: Association
between cytokines in induced sputum and severity of chronic
obstructive pulmonary disease. Respir Med 2006, 100(5):846–854. Epub
2005 Oct 7.
14. Sørensen GL, Hjelmborg JB, Kyvik KO, Fenger M, Høj A, Bendixen C,
Sørensen TI, Holmskov U: Genetic and environmental influences of
surfactant protein D serum levels. Am J Physiol Lung Cell Mol Physiol 2006,
290(5):L1010–L1017.
15. Sims MW, Tal-Singer RM, Kierstein S, Musani AI, Beers MF, Panettieri RA,
Haczku A: Chronic obstructive pulmonary disease and inhaled steroids
alter surfactant protein D (SP-D) levels: a cross-sectional study. Respir Res
2008, 9:13. doi:10.1186/1465-9921-9-13.
16. Ishikawa N, Hattori N, Tanaka S, Horimasu Y, Haruta Y, Yokoyama A, Kohno
N, Kinnula VL: Levels of surfactant proteins A and D and KL-6 are
elevated in the induced sputum of chronic obstructive pulmonary
disease patients: a sequential sputum analysis. Respiration 2011,
82(1):10–18.
17. Gunen H, Hacievliyagil SS, Yetkin O, Ibas G, Mutlu LC, Pehlivan E: Prevalence
of COPD: first epidemiological study of a large region in Turkey. Eur J
Intern Med 2008, 19:499–504.
18. Wedzicha JA, Donaldson GC: Exacerbations of chronic obstructive
pulmonary disease. Respir Care 2003, 48:1204–1213.
19. Agusti AG, Noguera A, Sauleda J, Sala E, Pons J, Busquets X: Systemic
effects of chronic obstructive pulmonary disease. Eur Respir J 2003,
21:347–360.
20. Wouters EF, Groenewegen KH, Dentener MA, Vernooy JH: Systemic
inflammation in chronic obstructive pulmonary disease: the role of
exacerbations. Proc Am Thorac Soc 2007, 4:626–634.
21. Sin DD, Pahlavan PS, Man SF: Man surfactant protein D:A lung specific
biomarker in COPD? Ther Adv Respir Dis 2008, 2:65–74.
22. Shakoori TA, Sin DD, Ghafoor F, Bashir S, Bokhari SN: Serum surfactant
protein D during acute exacerbations of chronic obstructive pulmonary
disease. Dis Markers 2009, 27:287–294.
doi:10.1186/2049-6958-8-36
Cite this article as: Akinci Ozyurek et al.: Value of serum and induced
sputum surfactant protein-D in chronic obstructive pulmonary disease.
Multidisciplinary Respiratory Medicine 2013 8:36.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
ORIGINAL RESEARCH ARTICLE
Open Access
Predictive value of troponins and simplified
pulmonary embolism severity index in patients
with normotensive pulmonary embolism
Savas Ozsu1*, Yasin Abul1, Asim Orem2, Funda Oztuna1, Yilmaz Bulbul1, Huseyin Yaman2 and Tevfik Ozlu1
Abstract
Background: To investigate whether 2 cardiac troponins [conventional troponin-T(cTnT) and high sensitive
troponin-T(hsTnT)] combined with simplified pulmonary embolism severity index (sPESI), or either test alone are
useful for predicting 30-day mortality and 6 months adverse outcomes in patients with normotensive pulmonary
embolism(PE).
Methods: The prospective study included 121 consecutive patients with normotensive PE confirmed by
computerized tomographic(CT) pulmonary angiography. The primary end point of the study was the 30-day
all-cause mortality. The secondary end point included the 180-day all-cause mortality, the nonfatal symptomatic
recurrent PE, or the nonfatal major bleeding.
Results: Overall, 16 (13.2%) out of 121 patients died during the first month of follow up. The predefined hsTnT
cutoff value of 0.014 ng/mL combined with a sPESI ≥1 'point(s) were the most significant predictor for 30-day
mortality [OR: 27.6 (95% CI: 3.5–217) in the univariate analysis. Alone, sPESI ≥1 point(s) had the highest negative
predictive value for both 30-day all-cause mortality and 6-months adverse outcomes,100% and 91% respectively.
Conclusions: The hsTnT assay combined with the sPESI may provide better predictive information than the cTnT
assay for early death of PE patients. Low sPESI (0 points) may be used for identifying the outpatient treatment for
PE patients and biomarker levels seem to be unnecessary for risk stratification in these patients.
Keywords: Prognosis, Pulmonary embolism, Risk scores, Troponins
Background
Hemodynamic parameters, including systemic pressure
and heart rate, and associated comorbidities such as malignancy, heart failure, or pulmonary diseases, are important prognostic factors in patients with pulmonary
embolism(PE) at hospital admission [1-3]. Several models
have been used to determine the prognosis of PE [4-6].
The Pulmonary Embolism Severity Index(PESI) is one of
the validated scores used on admission for estimating the
30-day mortality [7]. Currently, European Society of
Cardiology(ESC) guidelines recommend a risk stratification according to the presence of hypotension/shock, right
ventricular dysfunction (e.g. echocardiography, spiral
* Correspondence: [email protected]
1
Department of Pulmonary Medicine, Karadeniz Technical University, School
of Medicine, Trabzon, Turkey
Full list of author information is available at the end of the article
computed tomography, or brain natriuretic peptide
testing) or myocardial injury (e.g. cardiac troponin T or I
testing) [8]. In addition, clinical scores have been used to
predict adverse outcomes in acute PE regardless of imaging or biomarkers [9].
Laboratory biomarkers, particularly cardiac troponins,
have been shown to identify patients with a high risk for
mortality and an unfavourable prognosis during the
acute phase of PE [10]. A very low amount of troponin
can be detected in the blood of the general population
with currently available highly sensitive assays and these
assays have been reported to produce measures that
relate to adverse cardiovascular outcomes [8,11,12].
Elevated troponin levels have been reported in various
chronic diseases apart from acute myocardial infarctions,
including diabetes and chronic renal disease [10,12].
© 2013 Ozsu et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
We aimed to investigate whether risk stratification by
assays of cardiac troponin levels, including conventional
troponin-T(cTnT) and highly sensitive troponin-T
(hsTnT) combined with the simplified PESI(sPESI) improves the prediction of 30-day short term and 6 months
long term clinical outcomes for PE patients. We further
aimed to determine whether a combination of these
tools is capable of providing important additive prognostic knowledge and particularly whether it provides a
practical method for the determination of low-risk patients more easily than either test alone.
Methods
Study design
Prospectively the study enrolled 121 consecutive patients
with normotensive acute PE. The study was approved by
the local ethical committee and written informed consent was obtained from all patients.
Page 2 of 8
performed by an experienced echocardiographer were
blinded to the results of biochemical assays.
Right ventricular dysfunction(RVD) was defined as dilatation of the right ventricle (end-diastolic diameter > 30 mm
from the parasternal view or a right/left ventricular
diameter ratio ≥ 1.0 from the subcostal or apical view),
with hypokinesis of the right ventricular free wall (any
view), or a tricuspid systolic valve > 30 mm-Hg from
the apical or subcostal 4-chamber view [15]. The echocardiographic readers were blinded to the results of the
patient data.
PE-related mortality was defined as death caused by
right ventricular insufficiency or recurrent PE in the absence of an alternative diagnosis (for example, terminal
cancer). A sudden or unexpected death was considered
as a possible fatal PE in a patient.
Study outcomes
Patients and settings
All diagnoses in PE patients were confirmed by contrastenhanced computerized tomographic pulmonary angiography. The diagnosis of PE was based on the clinical
probability and a positive (≥500 μg/L) D-dimer ELISA
test [13,14]. D-dimer test was requested in case of low
clinical probability only. The records of all patients diagnosed in our hospital were analyzed on admission. PE
patients with shock or hypotension (high risk: defined by
the ESC as a systolic blood pressure of 90 mmHg or a
pressure drop of ≥ 40 mm Hg for 15 min if not caused
by new onset arrhythmia) [8] were excluded from the
study.
We determined test characteristics of the sPESI and of
the two different cardiac troponin assays’ (cTnT and
hsTnT) in their prognostic role for predicting the 30-day
outcome (mortality, nonfatal recurrent venous thromboembolism, or nonfatal major bleeding) and 180-day
mortality. The sPESI was calculated giving one point
for the presence of every of the following parameters:
(1) age > 80 years; (2) having a cancer; (3) history of chronic
cardiac or pulmonary disease; (4) heart rate > 110 bpm;
(5) systolic blood pressure 90 to 100 mm Hg; and (6)
arterial oxyhemoglobin saturation <90% measured at
the time of PE diagnosis [11]. Missing data were considered to be normal. Patients were divided in two
groups, one at a low-risk (0 points) and the other at a
high-risk (≥ 1 point[s]).
Echocardiographic examination
All patients were examined by two-dimensional, pulsewave Doppler echocardiography within the first 24 hours
after a diagnosis of PE, using a Vivid 7 (GE Vingmed
Ultrasound, Horten, Norway) with a 2.5-MHz transducer.
The transthoracic echocardiography (TTE) examinations
The primary end point of the study was the adverse 30-day
outcome, defined as death from any cause. Secondary end
points were 1) nonfatal recurrent venous thromboembolism, 2) nonfatal major bleeding, 3) all-cause mortality within
a 6-month follow-up period. The long-term (6-month)
status of patients who had been discharged from the
hospital was followed by an outpatient visit or by a telephone interview with the patient or his/her treating
physician.
Nonfatal bleeding events were classified as major if they
were overt and 1) occurred in a critical organ (e.g. intracranial, intraocular, or retroperitoneal hemorrhage), 2)
were associated with a drop in the hemoglobin level of
2.0 g/dL or more, 3) required a transfusion of 2 units of
blood or more [16].
Patients with symptoms or signs of recurrent PE were
assessed with objective tests. Recurrent PE was diagnosed by the presence of a new intraluminal filling
defect or an extension of a previous filling defect on
computed tomography pulmonary angiography.
Biochemical analysis
Venous blood samples were collected on admission.
Troponin-T levels were determined by a quantitative
electrochemiluminescence assay (Elecsys 2010; Roche,
Mannheim, Germany, cut-off value <0.010 ng/ml) on admission. Samples for hsTroponin-T measures were immediately
centrifuged, frozen and stored at -80°C. hsTroponin-T levels
were defined by quantitative electrochemiluminescence
immunoassays (Elecsys 2010 analyzer, Roche Diagnostics,
Mannheim, Germany) with a cut-off value ≥ 0.014 ng/mL).
A positive troponin test result was defined as a troponin level
above the manufacturers assay threshold for the diagnosis of
myocardial injury.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
Page 3 of 8
Statistical analysis
The Kolmogorov-Smirnov test was used to assess a normal distribution of continuous variables. Data characterized by a normal distribution were expressed as mean
values and standard deviation. Parameters without such
distribution were expressed as median with the range.
Student’s test (normal distribution) or Mann-Whitney’s
(non-normal distribution) test was used for comparing
the two groups. Discrete variables were compared using
the Fisher exact test (chi-square test). Sensitivity, specificity, positive predictive value, negative predictive value
and accuracy were calculated according to standard formulae. The prognostic relevance of the hsTnT or cTnT
levels, and of the sPESI, with regard to 30-day outcomes
was estimated by using a logistic regression analysis.
Odds ratios (OR) and the corresponding 95% confidence
intervals were calculated. P < 0.05 was considered statistically significant. Data were analyzed using SPSS statistical software.
Results
The patients’ characteristics are summarized in Table 1.
The median age was 70 years, ranging from 21 to 104
(25th–75th percentile: 55-76) years, and 52 (43%) were
males. The most frequent presenting symptom was dyspnea (75%), chest pain or pleuritic pain (49%), hemoptysis
(16%), and syncope (14%). The risk factors for PE include
Table 1 Characteristic features of patients included in the study
Demographic factors
All patients
Death (any cause) at 30 days
No
Yes
(n = 105)
(n = 16)
p
Male sex
52
45
7
%
43
43
44
NS
Median age (25th to 75th percentile)
70 (55-76)
70 (54-75)
77 (69-85)
0.003
Age > 80 years-(n) %
13
7
6
NS
11
7
38
Median pulse (25th to 75th percentile)
90 (80-108)
88 (80-100)
120 (89-129)
0.001
Pulse > 110 beats/min-(n) %
30
21
9
0.004
25
20
56
120 (110-130)
120 (110-130)
110 (100-130)
NS
NS
Clinical findings
Median (25th to 75th percentile) SBP
SBP < 100 mm Hg-(n) %
Arterial oxyhemoglobin saturation (SaO2) < 90% (n=108)-(n)%
14
11
3
12
11
19
21
14
7
19
15
44
28
20
8
23
19
50
9
8
1
7
8
6
19
15
4
16
14
25
76
60
16
63
57
100
0.014
Comorbidities
Cancer-(n) %
COPD-(n) %
CHF-(n) %
0.011
NS
NS
Prognostic factors
sPESI≥1-(n) %
cTn-T≥0.01 ng/mL -(n) %
hsTn-T≥0.014 ng/mL-(n) %
50
37
13
41
35
81
66
51
15
55
49
94
<0.001
0.001
0.001
Data are presented as median (interquartile range) and % value.
CHF, congestive heart failure; COPD, chronic obstructive lung disease; NS, not significant; RVD, right ventricular dysfunction; SBP, systolic blood pressure; sPESI,
simplified pulmonary embolism severity index.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
immobility (25%), surgery (18%), cancer (23%), and other
unspecified, more rare, causes (16%).
The median hsTnT level was 0.016, ranging from
0.003 to 0.56 ng/mL (25th–75th percentile, 0.005-0.037).
A total of 66(55%) patients had hsTn–T levels ≥0.014.
The median cTnT level was 0.01 ranging from to 0.010.39, (25th–75th percentile, 0.01-0.027).
A transthoracic echocardiogram was evaluated in 113
patients (93%). Out of these, 53 (47%) were diagnosed
with RVD. Out of 53 patients with RVD, 68% had
hsTnT levels ≥0.014. while 57% had cTnT levels ≥0.01
(p = 0.003, and p = 0.001 respectively).
The sPESI classified 76 patients (62.8%) in the highrisk group (≥ 1 point[s]). Patients with a sPESI high risk
presented with a positive cTnT level (48%, 37 pts) and a
positive hsTnT level (68.4%, 52 pts) (p=0.033, and
p<0.001, respectively).
30-day mortality
Out of the 121 study patients, 16 (13%) died within the
first month after diagnosis. In six of them (38%) the
cause of death was directly related to the PE episode,
whereas other deaths were caused by cancer (31%; 5 out
of 16 deaths), pneumonia (12.5%; 2 out of 16 deaths),
and other diseases (19%, 3 out of 16 deaths).
All the 14 patients with a low sPESI had positive
hsTnT levels and 13 out of them had positive cTnT
levels. None of these patients had adverse events.
As shown in Table 2, alone sPESI ≥ 1 point(s) had a
higher sensitivity, and a higher negative predictive value
for predicting a 30-day mortality in the present study.
None of the patients with hsTnT levels < 0.014 and a
sPESI < 1, or with cTnT levels < 0.014 and a sPESI < 1
(n = 31, 26%) or with cTnT levels < 0.01 and sPESI <1
(n = 33, 27%) died during the study period. Overall, the
risk assessment based on a positive hsTnT level (OR
12.4, 95% CI 1.5–99.3; p = 0.018) maintained its prognostic value for a 30-day mortality when adjusted for the
sPESI (OR: 9.3, 95%CI 1.1–75.4; p = 0.036).
Overall, the risk assessment based on a positive cTnT
level (OR 2.9, 95% CI 1.5–5.6; p = 0.002) maintained its
Page 4 of 8
prognostic value for a 30-day mortality when adjusted
for a sPESI (OR 6.5, 95% CI 1.7–25.2 p=0.007).
Combination model
We investigated the combination of troponins and the
sPESI with regard to risk stratification of PE. Upon
univariate analysis, hsTnT levels ≥14 ng/mL plus a
sPESI ≥ 1 point(s), which represents the high risk PE
patients was associated with a 27.6-fold (95% CI: 3.5217.0, p = 0.002) increased risk of 30-day mortality
(Table 3). However multivariate analysis of these parameters was not statistically significant (data not shown).
The 30-days mortality rate rose from 0% to 0.8% in
patients with sPESI ≥ 1 or hsTnT ≥ 0.014 ng/mL, and
further to 12.4% in those with sPESI ≥ 1 and hsTnT ≥
0.014 ng/mL (p < 0.001; Figure 1).
The 30-days mortality rate rose from 0% to 2.5% in patients with sPESI≥1 or cTnT levels≥0.01, and further to
10.7% in those with sPESI ≥1 and hsTnT ≥0.014 ng/mL
(p < 0.001; Figure 2).
sPESI and hs-Tn-T for prediction of 6-month outcome
Overall, 28 patients (21.1%) reached the secondary end
point including nonfatal recurrent venous thromboembolism (n = 3), nonfatal major bleeding (n = 3) and
all-cause mortality within a 6-month period.
During the follow-up period, a total of 22 deaths (18%
of the all patients) was recorded. Out of these, 16 (13%)
were due to the initial PE event (all within the first 30
days), and 1 (1%) to fatal recurrent PE (only one occurred after day 30). Also, 5 deaths (4%) were due to a
malignancy. Out of 55 patients with hsTnT <0.014 ng/mL
on admission, 3 (5.5%) died; of 45 patients with a sPESI
of 0, one (2.2%) died; of 72 patients with cTnT level
<0.01 on admission, 6 (9%) died. Alone sPESI ≥ 1 point(s)
has the highest negative predictive value and sensitivity for
the long-term adverse outcomes (Table 4).
Discussion
There are three main conclusions that follow from the
present results. Firstly, the sPESI is more useful for
predicting the long term adverse outcomes. Secondly, a
Table 2 sPESI and troponins prediction rule test characteristics for 30-day mortality
Sensitivity, %
(95% CI)
Specificity, %
(95% CI)
Negative predictive
value, % (95% CI)
Positive predictive
value, % (95% CI)
sPESI ≥ 1 point(s)
100 (76-100)
43 (33-53)
100 (90-100)
21 (13-32)
hsTn-T ≥ 0.014 ng/mL
94 (68-100)
51 (42-61)
98 (89-100)
23 (14-35)
cTn-T ≥ 0.01 ng/mL
81 (54-95)
65 (55-74)
96 (87-99)
26 (15-41)
hsTnT ≥ 0.014 ng/mL+ sPESI ≥ 1 point(s)
94 (68-10)
65 (55-74)
99 (91-100)
29 (18-43)
cTnT ≥ 0.01+ sPESI ≥ 1 point(s)
81 (54-95)
77 (68-85)
96 (89-99)
35 (21-53)
RVD on echocardiography
19 (1-32)
95 (85-99)
57 (47-67)
77 (46-94)
CI, confidence interval; RVD, Right ventricula r dysfunction; sPESI, simplified Pulmonary Embolism Severity Index.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
Page 5 of 8
Table 3 Predictors of 30-day mortality (univariate
analysis)
OR 95%
CI
P
sPESI ≥ 1 point(s)
12.7
1.6-98.9
NS
RVD
5.6
1.5-21.0
0.011
hsTnT ≥ 14 pg/mL
4.0
1.4-11.2
0.009
cTnT ≥ 001
2.8
1.5-5.4
0.002
hsTnT ≥ 14 pg/mL+ sPESI ≥ 1 point(s)
27.6
3.5-217.0
0.002
cTnT ≥ 001+ sPESI ≥ 1 point(s)
14.6
3.8-55.6
<0.001
OR, odds ratio; RVD, Right ventricular dysfunction; sPESI, simplified Pulmonary
Embolism Severity Index.
combination model of hsTnT levels ≥ 0.014 ng/mL with
a sPESI ≥ 1 may be used for the short term mortality
risk. Thirdly, sPESI ≥ 1 showed the high negative predictive value (100%) for 30-day mortality but PE patients
had various clinical presentations leading to different
prognostic and therapeutic approaches. Accurate risk
stratification with precise diagnostic tools is of crucial
importance.
Right ventricular dysfunction on echocardiography/
computed tomography as well as cardiac markers, including troponins and clinical scores, are important
tools for accurate risk stratification. There is only one
study comparing the sPESI with any troponins(including
hsTnT) levels, but this study population was composed
of patients with massive PE [17]. Another study only
compared the prognostic role of the hsTnT assay and of
the sPESI [18]. Thus, comparisons of 2 cardiac troponins
(hsTnT and cTnT) combined with the sPESI or alone
are limited in the literature.
In our study three patients in the group with negative
cTnT levels died in the early period compared to only
one patient who died among the groups with negative
hsTnT levels. The negative predictive value for the sPESI
was 100% for a 30-day mortality. We agree with Lankeit
et al. who found a 100% NPV of PE for the 30-day mortality [18]. In addition, no patient in the group with a
combination of negative hsTnT levels and sPESI < 1
died. As a result it was found that, although the negative
hsTnT level had a similar performance as the low sPESI
for predicting adverse outcomes, it was obviously superior to the cTnT assay.
Mortality of PE has been defined to be <1% in patients
without RVD on echocardiography or computerized
tomography, and also with no elevations in biomarkers
[9]. However, advanced age and associated comorbidities
may increase the mortality for PE. Therefore, the
addition of the sPESI to the biomarkers and to RVD
may provide more accurate risk stratification of PE. Any
patient with PE and one of the following factors (age
Figure 1 Frequency of an adverse 30-day mortality according to baseline hsTnT levels and the sPESI. hsTnT indicates high-sensitivity
troponin T assay; sPESI, simplified PulmonaryEmbolism Severity Index.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
Page 6 of 8
Figure 2 Frequency of an adverse 30-day mortality according to baseline cTnT levels and the sPESI. cTnT indicates conventional troponin
T assay; sPESI, simplified PulmonaryEmbolism Severity Index.
over 80, presence of cardiopulmonary diseases and presence of cancer) has been classified as high risk patient,
thus causing an overestimation of the risk stratification
for these PE patients. Therefore, specificity of the high
risk sPESI is lower than that of cardiac biomarkers and
of right ventricular dysfunction on echocardiography for
PE mortality [17,19]. The specificity of echocardiography
decreases from 78% to 17–22% in PE patients with accompanying comorbidities [8]. However, a favourable
prognosis of PE can be easily estimated when the sPESI
is low. According to the sPESI model the 30-day overall
mortality in the low risk group has been reported to be
between 0% and 2% [16,17]. Fourteen patients with a
positive hsTnT assay had a low sPESI in our study.
However, none of these PE patients with positive
ahsTnT level had an adverse event. Relatively to the
good prognosis for PE patients with a low sPESI, the
hsTnT assay may be an unnecessary marker, especially
in those patients who are in the low sPESI group.
Interestingly, in the present study the 30-day mortality
was found to be 0.8 for patients that only had an
hsTnT ≥ 0.014 ng/mL or a sPESI ≥ 1. Lankeit et al. found
a 3.6% adverse outcome in the same patients population.
However, one third of their study population had renal
failure which could be associated with positive troponin
values in that study [18]. Therefore combination models
may provide much more information about the prognosis
of PE patients and prevent unnecessary interventions in
Table 4 sPESI and troponins prediction rule test characteristics for 180-day outcome
Sensitivity, %
(95% CI)
Specificity, %
(95% CI)
Negative predictive
value, % (95% CI)
Positive predictive
value, % (95% CI)
sPESI ≥ 1 point(s)
86 (66-95)
44 (34-55)
91 (78-97)
31 (22-43)
hsTn-T ≥ 0.014 ng/mL
79 (56-91)
53 (42-63)
89 (77-95)
33 (23-46)
cTn-T ≥ 0.01 ng/mL
68 (48-83)
67 (56-76)
87 (77-94)
38 (25-53)
hsTnT ≥ 0.014 ng/mL+ sPESI ≥ 1 point(s)
75 (55-86)
67 (56-76)
90 (80-95)
40 (27-55)
cTnT ≥ 0.01+ sPESI ≥ 1 point(s)
64 (44-81)
80 (70-87)
88 (79-94)
49 (32-65)
CI, confidence interval; sPESI, simplified Pulmonary Embolism Severity Index.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
these groups of patients. Outpatient management of low
risk patients with PE may improve the quality of life, and
provide reductions of cost [20].
Combinations of prognostic tools including multiple
biomarker assay, biomarker plus right ventricular dysfunction (both on echocardiography/tomography) and
PESI (not simplified) plus shock index were found to be
more predictive than biomarkers and PESI only for the
risk stratification of PE patients [21-24]. In patients with
hsTnT level ≥ 0.014 ng/mL plus a sPESI ≥ 1 there was a
94% risk of 30 day all-mortality and a mortality rate
12.4%. Lankeit et al. reported the 30 day adverse outcome as 10.4% in the same group [18]. In SWIVTER
study it was found that patients with a high sPESI plus
any positive troponin test (conventional troponin T or I,
highly sensitive troponin T) had a mortality rate of
10.3% [17]. Moreover, the mortality rate was found to be
15.4% in a group where the PESI (not simplified) was
combined with troponin-I in another study [25]. It remains unclear whether thrombolysis may improve the
early and long-term clinical outcomes of selected
normotensive patients with a high risk score and/or with
biomarker positivity. The PEITHO trial, a prospective,
multicenter, international, randomized, double-blind study
is currently comparing thrombolysis with tenecteplasevs
placebo in a normotensive patient group with confirmed
PE (NCT00639743).
Of course there are some limitations in the present
study. Firstly, our study population is relatively small,
and secondly, we did not study hsTnT testing at the 3rd
hour of admission which has 100% negative predictive
value for the exclusion of myocardial infarction. In
addition, when interpreting our results it should also be
considered that no autopsy was performed. The third
concern may be related to the recurrent PE which was
diagnosed by the presence of a new intraluminal filling
defect or an extension of a previous filling defect on
computed tomography pulmonary angiography. Because the whole diagnosis of PE patients was initially
confirmed by contrast-enhanced computerized tomographic pulmonary angiography in the present study,
we did not use perfusion lung scan which could be
feasible for the recurrent PE and for the follow up of
those PE patients.
Conclusion
Although the present study was conducted on a limited
number of patients, the hsTnT assay combined with the
sPESI may provide more predictive information than the
cTnT assay for the prognosis of PE. Particularly, a low
sPESI may be used for the identification of outpatient
treatment options and in these patients biomarker levels
seem to be unnecessary for the prognosis of PE.
Page 7 of 8
The study was accepted as a poster by ERS 2012
congress. This study was conducted at Farabi Hospital,
Trabzon, Turkey.
Competing interests
The authors of this manuscript have no conflicts of interest or any personal/
financial support or involvement with organization(s) with financial interest
in the subject matter.
Acknowledgments
The authors thank Prof. RW Guillery from Oxford University for the correction
of the English language of the manuscript.
Author details
1
Department of Pulmonary Medicine, Karadeniz Technical University, School
of Medicine, Trabzon, Turkey. 2Biochemistry, Karadeniz Technical University,
School of Medicine, Trabzon, Turkey.
Received: 30 December 2012 Accepted: 18 March 2013
Published: 28 May 2013
References
1. Kasper W, Konstantinides S, Geibel A, Olschewski M, Heinrich F, Grosser KD,
Rauber K, Iversen S, Redecker M, Kienast J: Management strategies and
determinants of outcome in acute major pulmonary embolism: Results
of a multicenter registry. J Am Coll Cardiol 1997, 30:1165–1171.
2. Kucher N, Rossi E, De Rosa M, Goldhaber SZ: Massive pulmonary
embolism. Circulation 2006, 113:577–582.
3. Goldhaber SZ, Visani L, De Rosa M: Acute pulmonary embolism: Clinical
outcomes in the international cooperative pulmonary embolism registry
(icoper). Lancet 1999, 353:1386–1389.
4. Wicki J, Perrier A, Perneger TV, Bounameaux H, Junod AF: Predicting
adverse outcome in patients with acute pulmonary embolism: A risk
score. Thromb Haemost 2000, 84:548–552.
5. Uresandi F, Otero R, Cayuela A, Cabezudo MA, Jimenez D, Laserna E, Conget
F, Oribe M, Nauffal D: A clinical prediction rule for identifying short-term
risk of adverse events in patients with pulmonary thromboembolism.
Arch Bronconeumol 2007, 43:617–622.
6. Aujesky D, Roy PM, Le Manach CP, Verschuren F, Meyer G, Obrosky DS,
Stone RA, Cornuz J, Fine MJ: Validation of a model to predict adverse
outcomes in patients with pulmonary embolism. Eur Heart J 2006,
27:476–481.
7. Aujesky D, Obrosky DS, Stone RA, Auble TE, Perrier A, Cornuz J, Roy PM,
Fine MJ: Derivation and validation of a prognostic model for pulmonary
embolism. Am J Respir Crit Care Med 2005, 172:1041–1046.
8. Torbicki A, Perrier A, Konstantinides S, Agnelli G, Galie N, Pruszczyk P, Bengel
F, Brady AJ, Ferreira D, Janssens U, Klepetko W, Mayer E, Remy-Jardin M,
Bassand JP: Guidelines on the diagnosis and management of acute
pulmonary embolism: The task force for the diagnosis and management
of acute pulmonary embolism of the european society of cardiology
(ESC). Eur Heart J 2008, 29:2276–2315.
9. Jaff MR, McMurtry MS, Archer SL, Cushman M, Goldenberg N, Goldhaber SZ,
Jenkins JS, Kline JA, Michaels AD, Thistlethwaite P, Vedantham S, White RJ,
Zierler BK: Management of massive and submassive pulmonary
embolism, iliofemoral deep vein thrombosis, and chronic
thromboembolic pulmonary hypertension: A scientific statement from
the american heart association. Circulation 2011, 123:1788–1830.
10. Becattini C, Vedovati MC, Agnelli G: Prognostic value of troponins in acute
pulmonary embolism: A meta-analysis. Circulation 2007, 116:427–433.
11. Jimenez D, Aujesky D, Moores L, Gomez V, Lobo JL, Uresandi F, Otero R,
Monreal M, Muriel A, Yusen RD: Simplification of the pulmonary embolism
severity index for prognostication in patients with acute symptomatic
pulmonary embolism. Arch Intern Med 2010, 170:1383–1389.
12. Masson S, Anand I, Favero C, Barlera S, Vago T, Bertocchi F, Maggioni AP,
Tavazzi L, Tognoni G, Cohn JN, Latini R: Valsartan Heart Failure Trial
(Val-HeFT) and Gruppo Italiano per lo Studio della Sopravvivenza
nell’Insufficienza Cardiaca–Heart Failure (GISSI-HF) Investigators; Serial
measurement of cardiac troponin T using a highly sensitive assay in
patients with chronic heart failure: data from 2 large randomized clinical
trials. Circulation 2012, 125:280–288.
Ozsu et al. Multidisciplinary Respiratory Medicine 2013, 8:34
http://www.mrmjournal.com/content/8/1/34
Page 8 of 8
13. Wells PS, Ginsberg JS, Anderson DR, Kearon C, Gent M, Turpie AG, Bormanis
J, Weitz J, Chamberlain M, Bowie D, Barnes D, Hirsh J: Use of a clinical
model for safe management of patients with suspected pulmonary
embolism. Ann Intern Med 1998, 129:997–1005.
14. British Thoracic Society Standards of Care Committee Pulmonary Embolism
Guideline Development Group: British thoracic society guidelines for the
management of suspected acute pulmonary embolism. Thorax 2003,
58:470–483.
15. Grifoni S, Olivotto I, Cecchini P, Pieralli F, Camaiti A, Santoro G, Conti A,
Agnelli G, Berni G: Short-term clinical outcome of patients with acute
pulmonary embolism, normal blood pressure, and echocardiographic
right ventricular dysfunction. Circulation 2000, 101:2817–2822.
16. Lankeit M, Gómez V, Wagner C, Aujesky D, Recio M, Briongos S, Moores L,
Yusen RD, Konstantinides S, Jimenez D: A strategy combining imaging and
laboratory biomarkers in comparison to a simplified clinical score for risk
stratification of patients with acute pulmonary embolism. Chest 2012,
141:916–922.
17. Spirk D, Aujesky D, Husmann M, Hayoz D, Baldi T, Frauchiger B, Banyai M,
Baumgartner I, Kucher N: Cardiac troponin testing and the simplified
pulmonary embolism severity index. SWIssVenous
ThromboEmbolismRegistry (SWIVTER). Thromb Haemost 2011, 106:978–984.
18. Lankeit M, Jimenez D, Kostrubiec M, Dellas C, Hasenfuss G, Pruszczyk P,
Konstantinides S: Predictive value of the high-sensitivity troponin t assay
and the simplified pulmonary embolism severity index in
hemodynamically stable patients with acute pulmonary embolism: A
prospective validation study. Circulation 2011, 124:2716–2724.
19. Vanni S, Nazerian P, Pepe G, Baioni M, Risso M, Grifoni G, Viviani G, Grifoni S:
Comparison of two prognostic models for acute pulmonary embolism:
clinical vs. right ventricular dysfunction-guided approach. J Thromb
Haemost 2011, 9:1916–1923.
20. Agterof MJ, Schutgens RE, Snijder RJ, Epping G, Peltenburg HG, Posthuma
EF, Hardeman JA, van der Griend R, Koster T, Prins MH, Biesma DH: Out of
hospital treatment of acute pulmonary embolism in patients with a low
NTt-proBNP level. J Thromb Haemost 2010, 8:1235–1241.
21. Binder L, Pieske B, Olschewski M, Geibel A, Klostermann B, Reiner C,
Konstantinides S: N-terminal pro-brain natriuretic peptide or troponin
testing followed by echocardiography for risk stratification of acute
pulmonary embolism. Circulation 2005, 112:1573–1579.
22. Kostrubiec M, Pruszczyk P, Bochowicz A, Pacho R, Szulc M, Kaczynska A,
Styczynski G, Kuch-Wocial A, Abramczyk P, Bartoszewicz Z, Berent H,
Kuczynska K: Biomarker-based risk assessment model in acute pulmonary
embolism. Eur Heart J 2005, 26:2166–2172.
23. Ozsu S, Karaman K, Mentese A, Ozsu A, Karahan SC, Durmus I, Oztuna F,
Kosucu P, Bulbul Y, Ozlu T: Combined risk stratification with computerized
tomography/echocardiography and biomarkers in patients with
normotensive pulmonary embolism. Thromb Res 2010, 126:486–492.
24. Sam A, Sanchez D, Gomez V, Wagner C, Kopecna D, Zamarro C, Moores L,
Aujesky D, Yusen R, Jimenez Castro D: The shock index and the simplified
PESI for identification of low-risk patients with acute pulmonary
embolism. Eur Respir J 2011, 37:762–766.
25. Moores L, Aujesky D, Jimènez D, Diaz G, Gómez V, Marti D, Briongos S,
Yusen R: Pulmonary Embolism Severity Index and troponin testing for
the selection of low-risk patients with acute symptomatic pulmonary
embolism. J Thromb Haemost 2010, 8:517–522.
doi:10.1186/2049-6958-8-34
Cite this article as: Ozsu et al.: Predictive value of troponins and
simplified pulmonary embolism severity index in patients with
normotensive pulmonary embolism. Multidisciplinary Respiratory Medicine
2013 8:34.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
ORIGINAL RESEARCH ARTICLE
Open Access
CD24+/CD38- as new prognostic marker for
non-small cell lung cancer
Feridoun Karimi-Busheri1,2*, Aghdass Rasouli-Nia2, Victoria Zadorozhny1 and Habib Fakhrai1
Abstract
Background: Lung cancer is the leading cause of death among cancers in the world. The annual death toll due to
this disease exceeds the combined deaths caused by colon, breast, prostate, and pancreatic cancers. As a result,
there has been a tremendous effort to identify new biomarkers for early detection and diagnosis of lung cancer.
Methods: In this study we report the results of screening a panel of eight non-small cell lung cancer (NSCLC) cell
lines originating from different subtypes of lung cancer in an attempt to identify potential biomarkers unique to
this disease. We used real-time polymerase chain reaction and flow cytometry techniques to analyze the expression
of ALDHA1, EpCAM, CD133, CD24, and CD38 in this panel.
Results: We demonstrate for the first time that the majority of NSCLC cells do not express levels of CD38 that
would qualify it as a new biomarker for the disease. In contrast, we found that CD24 is over-expressed in 6 out of 8
of the cell lines. The combined CD24+/CD38-/low phenotype was detected in 50% of the cell lines that are also
positive for CD133 and EpCAM.
Conclusions: We report that CD24+/CD38-/low signature could potentially be used as a new biomarker for the early
detection of NSCLC.
Keywords: Biomarkers, CD24, CD38, Non-small cell lung cancer
Background
Despite being the number one killer among all cancers,
potent biomarkers that can efficiently target a significant
number of lung tumor cells are far from having any
impact in prognosis and diagnostics of this malignancy.
The five-year survival rate of all patients is only 15% and
has not changed over the last thirty years [1]. According
to an estimate in 2007, the cost of detection and treatment
of lung cancer in the United States alone has been over
$5 billion dollars per year [2]; absorbing 20% of Medicare’s
total expenditures for cancer [3]. There is an intense effort
underway globally to identify new molecular markers
for Non-small cell lung cancer (NSCLC), in particular
molecular biomarkers for the early detection as late stage
lesions are strongly associated with high mortality [4,5].
It is expected that future genetic markers together with
the current tumor, node, and metastasis classification will
* Correspondence: [email protected]
1
Stem Cell Department, NovaRx Corporation, 6828 Nancy Ridge Drive,
San Diego, USA
2
Department of Oncology, Cross Cancer Institute, University of Alberta,
Edmonton, Canada
significantly improve the prognosis of NSCLC and influence treatment decision [6]. The emergence of the “-omics”
era will likely revolutionize our approach towards the
discovery of biomarkers. Genomics, epigenomics, and proteomics are among the new technologies that have identified potential next-generation biomarkers [7]. Analysis
of microRNAs (miRNAs) and DNA methylation have led
to the identification of many promising biomarkers that
when integrated with other potential biomarkers could be
used for the early detection of high risk lung cancer
patients [4,8]. In a different study, proteomics analysis
of NSCLC has led to the identification of two new proteins,
PTRF/cavin-1 and MIF, as potential therapeutic targets [9].
The expression of aldehyde dehydrogenase A1 (ALDHA1)
in tumor cells is the focus of attention both in diagnostic
and therapeutic settings [10]. ALDH is an intracellular
enzyme involved in metabolism of various molecules within
cells such as retinoic acid, alcohol, cyclophosphamide,
oxidative stress response, and aldehyde produced during
lipid metabolism [11,12]. It has been reported that the
enzyme is highly expressed in some of the NSCLC cell
© 2013 Karimi-Busheri et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
lines and also in the patient’s specimen [12,13]. Although
little is known about epithelial cell adhesion molecule
(EpCAM) gene expression in NSCLC, a few studies have
reported the upregulation of EpCAM in NSCLC cell lines
and specimens, notably in squamous cell carcinoma
[14-16]. CD133, a transmembrane glycoprotein, has been
reported to be one of the most representative markers
of tumor initiating cells in various tumors such as glioblastoma and colorectal carcinoma [17,18]. The analysis
of CD133 expression in stage I lung adenocarcinoma
tumors has revealed an association with disease recurrence and led to the proposal that CD133 could be
used as an independent prognostic marker [19]. In the
last few years, increasing evidence has shed light on the
importance of CD24 as a potent prognostic marker in
breast, ovarian, NSCLC, and prostate cancers [5,20-22]. In
a previous study, we have shown that expression of the
cell surface protein CD38 is higher in cancer stem cells
isolated from the H460 NSCLC [23,24]. This is a multifunctional enzyme involved in cell adhesion, signal transduction, and as a receptor in cells of the immune system
[25]. CD38 contribution to disease progression and relapse in acute myeloid leukaemia and chronic lymphocytic leukemia is well established and the expression
of the enzyme is considered an important prognostic
marker in leukemia [26-28]. In the current study we have
assessed the validity of some of the most discussed potential
biomarkers of NSCLC, including CD38, in a panel of lung
cancer cell lines in search of potent prognostic markers
and signature phenotypes for NSCLC.
Methods
Material, cell lines, and culture media
All the cell lines (H460, A549, H661, H292, SW-900,
SK-MES, H596, and H520) were purchased from the
American Type Culture Collection (ATCC, Rockville, MD).
Cells were cultured and grown in media according to
ATCC recommendation. Dulbecco’s Modified Eagle
Medium/F12 (DMEM/F12) was obtained from SAFC
Biosciences (Lenexa, KS), B27 serum-free supplements
and penicillin/streptomycin were purchased from Life
Technologies (Carlsbad, CA), sodium bicarbonate and
sodium pyruvate were obtained from VWR (West Chester,
PA), basic fibroblast growth factor was purchased from
Millipore Inc. (Billerica, MA). Tissue culture suspension
plates and flasks were purchased from Sarstedt Inc.
(Newton, NC), and BioCoat collagen I coated plates
from BD Biosciences (San Jose, CA). ALDEFLUOR Assay
Kit was obtained from Stem Cell Technologies Inc.
(Vancouver, BC). Mouse anti-human CD24 phycoerythrinconjugated (PE) was purchased from BD Biosciences Inc.
(San Jose, CA), PE anti-human CD326 (EpCAM) and PE
anti-human CD38 antibody from Biolegend (San Diego,
CA), and mouse anti-human CD133/1 (AC133)-PE and
Page 2 of 9
CD133/2 from Miltenyi Biotec (Auburn, CA). All other
chemicals were purchased from Sigma-Aldrich (St. Louis,
MO) unless noted otherwise.
Flow cytometry analysis
Enriched populations of lungospheres were analyzed by
flow cytometry as described earlier [23,24]. Briefly, after
trypsinization and washing the cells with medium, 1 × 106
cells were passed through 0.45 μM filters to remove clumps
of cells followed by washing with FACS buffer (phosphate
saline buffer, 2% fetal bovine serum, and 2 mM ethylenediaminetetraacetic acid (EDTA)). Cells were centrifuged at
1,200 rpm for five minutes and the cell pellet was resuspended in 100 μl FACS buffer containing 20 μl of CD24,
CD38, or EpCAM antibodies. After incubation for 20 minutes on ice in the dark, cells were washed twice with 2 ml
of FACS buffer and after the final wash they were resuspended in 200–500 μl of FACS buffer. Cells were kept on
ice/dark prior acquisition on Attune Acoustic Focusing from
Applied Biosystems (Carlsbad, CA). As negative control, an
isotype-matched labeled control was used for each antibody.
Aldefluor assay
Aldefluor assay was performed according to the manufacturer instruction. Two sets of tubes were labeled as
sample and control for each cell line to be tested. To the
sample tube, 1 × 106 cells were added and to the control
tube 5 μl of diethylaminobenzaldehyde (DEAB), a specific
ALDH inhibitor. Cells in the sample tube were mixed with
5 μl of activated ALDEFLUOR and 0.5 ml of the mixture
was transferred to the control tube containing DEAB.
Tubes were vortexed and incubated at 37°C for 30 min.
Pelleted cells after centrifugation at 1000 rpm for 5 min
were resuspended in 500 μl aldefluor assay buffer and
analyzed on an Attune flow cytometer.
Real-time reverse transcriptase-PCR
RNA was isolated from 5 × 106 cells using Absolutely
RNA Miniprep kit (Stratagene) according to manufacturer’s
recommendations. The cDNA was synthesized by using
Transcriptor First Strand cDNA Synthesis Kit (Roche
Applied Science, Indianapolis, IN) from 0.5 μg of total
RNA. RNA was incubated with anchored-oligo(dT)18
primer for 10 min at 65°C to denature template-primer
mixture and chilled on ice. 5× reaction buffer, RNase
inhibitors, 10 mM dNTPs mix and transcriptor reverse
transcriptase were added to the reaction mixture and
incubated at 50°C for 60 min, followed by 85°C for
5 min to inactivate reverse transcriptase and chilled on ice.
Real-time PCR was performed using LightCycler 480
and LightCylcer 480 SYBR Green I Master (Roche
Applied Science). Master mixture containing cDNA,
Syber Green Master and 100 μM forward and reverse
primers were prepared on ice (Table 1). RT-PCR was
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
Page 3 of 9
Table 1 Primer used for RT-PCR
Gene
Accession
Forward primer
Reverse primer
CD24
NM_013230
CACGCAGATTTATTCCAGTGAAAC
GACCACGAAGA GACTGGCTGTT
CD38
NM_001775
TCTTGCCCAGACTGGAGAAAGG
TGGACCACATCACAGGCAGCTT
GAPDH
AF261085
ACCACAGTCCATGCCATCAC
TCCACCACCCTGTTGCTGTA
performed at an initial denaturation of 95°C for 5 min,
followed by 45 cycles of denaturation at 95°C for 10 sec,
annealing at 60°C for 20 sec, and elongation at 72°C for
18 sec. To ensure that the expected PCR products were
generated, melting curves were also analyzed. Relative
mRNA expression levels were obtained by normalizing
the amount of mRNA divided by that of GAPDH mRNA
as an endogenous control in each sample.
Results
Assurance of cell line identification
The authenticity of all eight NSCLC lines used in this
study were validated by short tandem repeated DNA sequence (STR) as described earlier [23]. Briefly, DNA was
extracted from the cell lines and amplified by PowerPlex
1.2 System (Promega, Madison WI) according to manufacturer instructions. The data then were analyzed on
Figure 1 Aldehyde dehydrogenase 1A (ALDH1) expression among the eight non-small cell lung carcinoma cell lines. DAEB, an inhibitor
of ALDH is used as negative control.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
Page 4 of 9
Table 2 Expression of potent biomarkers in a panel of non-small cell lung cancer cell lines
Name
Type
A549
Adenocarcinoma
ALDH
EpCAM
CD133/2
CD24
CD38
+
+
+
+
+
H460
Large-cell
+
+
+
+
-
H661
Large-cell
±
+
+
-
-
H520
Squamous cell carcinoma
+
+
+
+
-
H596
Squamous cell carcinoma
-
+
+
+
-
SW-900
Squamous cell carcinoma
+
+
±
+
+
SK-MES
Squamous cell carcinoma
±
+
+
-
-
H292
Mucoepidermoid pulmonary carcinoma
+
+
±
+
-
Figure 2 Expression of the EpCAM (CD326) in eight non-small cell lung carcinoma cell lines as measured by flow cytometry. IgG was
used as control.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
Page 5 of 9
Applied Biosystems ABI Prism 310 Genetic Analyzer.
The authentication of the cell lines were confirmed by
the perfect match between the cell lines data and the
parental cell lines released by American Type Culture
Collection [23].
from 15.3% in SW-900, 34.4% in H520, 42.5% in H292,
and 60.4% in A549. In the other four cell lines (H596,
H661, SK-MES, and H460) expression was not detected
or the level was very low (Figure 1). Table 2 summarizes
the results of ALDH and all other markers that follow.
Expression of ALDHA1
Expression of EpCAM (CD326)
We first analyzed the expression of aldehyde dehydrogenase in eight NSCLC cell lines using Aldefluor Assay
Kit (Stem Cell Technologies, Vancouver, BC) that is optimized for interaction with human ALDH 1A1. As a
negative control, cells were treated with DEAB, an inhibitor of aldehyde dehydrogenase. Our analysis showed
that half of the panel expresses a high level of ALDHA1
We next examined the expression of epithelial cell adhesion molecule (EpCam) in the eight cell lines (Figure 2).
All the lung cancer cell lines express EpCam. However,
no specific expression pattern was observed among these
NSCLC based on their histology. For example, large cell
carcinoma cell lines H520 and H460 display one of the
highest and lowest expression among the lung panel with as
Figure 3 Flow cytometric analysis of CD133/2 in non-small cell lung carcinoma cell lines.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
high as 56.0% in H520 to 7.1% in H460. Similarly, squamous
cell carcinoma cell lines express as high as 85.8% in
H520 to 12.5 and 12.6% in H596 and SW900, respectively.
Expression of CD133
All NSCLC cell lines used in this study express a low
level of CD133. The highest level was observed in A549
adenocarcinoma cell line with 10% and the lowest below
2% in SW-900 and H292 cells. The rest of the cell lines
has an expression of CD133 from 3.3% in SK-MES, 3.7%
in H460, 4.0% in H661, 6.0% in H520, and 7.6% in H596
(Figure 3).
Expression of CD24 and CD38
With the exception of H661 and SK-MES cells that
apparently do not express a detectable level of CD24
by flow cytometry, the expression of CD24 is very high
in the other six cell lines (Figure 4). The lowest level
was observed in H596 with 34.3% and the other cell
lines are all above 73% and close to 100% in H292 a
mucoepidermoid carcinoma cell line. In contrast the
expression of CD38 is predominantly low to absent in
the majority of the cell lines with the exception of A549,
63.0%, SW-900, 42.8%, and SK-MES, 35.1% (Figure 4).
Page 6 of 9
To validate the results of flow cytometry analysis, we
extracted RNA from all the cell lines and performed a
quantitative real-time PCR on the samples. As shown
in Figure 5, the RNA expressions were perfectly matched
with the flow cytometry results. We did not observe any
RNA expression for CD24 in H661 and SK-MES cell
lines, and no quantifiable CD38 RNA expression was seen
in the lung cancer cell lines that were CD38-/low by flow
cytometry.
Summary of the gene expression within the cell line panel
Tables 2 and 3 present an overall summary of the results
in order to provide an easy reference. Table 2 displays
the expression of the genes among the individual cell
lines and Table 3 summarizes the percentage of the genes
as potent prognostic and biomarkers for NSCLC.
Discussion and conclusions
In this study we provide a thorough analysis of five
biomarkers of NSCLC in a panel of eight cell lines representing different types of NSCLC. Approximately 80
percent of all lung cancers are classified as non-small cell,
which is further classified into three sub-types based
on their morphology and physiological characteristics:
squamous cell carcinoma, adenocarcinoma, and large-
Figure 4 Flow cytometry analysis of the expression of CD24 and CD38 in the eight cell lines panel of non-small cell lung carcinoma.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
Page 7 of 9
0.02
0.16
Target/reference Ratio
0.015
0.01
0.005
0
A549
H460
H661
H520
H596
Cell lines
SW-900
SK-MES
H292
Figure 5 Analysis of CD24 and CD38 expression by quantitative RT-PCR in non-small cell lung carcinoma cell lines.
cell undifferentiated carcinoma. Among these sub-types,
adenocarcinoma accounts for approximately 40%, followed
by squamous cell carcinoma with 25-30%, and large-cell
carcinoma with 10-15% [29].
The majority of information available on NSCLC is
based on the available cell lines. Fortunately, scientists
have access to a collection of over 200 lung cancer cell
lines for their research and this has led to more than
9000 citations on the disease [30]. The results obtained
from this extensive research indicate that there is a high
percentage of genomic similarities between lung cancer
cell lines and the tumor they have been isolated from
that provides a cushion of trust for the ongoing research
and the results obtained from the cell lines [30]. We are
therefore confident that our findings deliver robust and
reliable results that could be clinically significant for the
prognosis of NSCLC patients.
A previous report on the NCI60 tumor cell line panel
indicates that the expression of individual markers or
combination of markers was varied among a wide range
of cell lines including lung cancers [31]. One significant
difference with our results, however, lies in the nature of
the two panels. The NCI60 panel consists of 60 diverse
Table 3 An overall signature of non-small cell lung cancer
cell line panel and NSCLC tumor initiating cells*
Types
Signature
Large cells
ALDH+/CD38-/low/CD133+/EpCAM+
+
%
+
100
Squamous cell carcinoma
EpCAM /CD133
100
Overall
CD24+
75.0
-/low
CD38
CD24+/CD38-/low
+
75.0
50.0
ALDH
87.50
EpCAM+
100.0
* Excluding adenocarcinoma (insufficient data).
human cancer cell lines widely used as a screening tool
for drug discovery and representing nine distinct tumor
types: leukemia, colon, lung, central nervous system, renal,
melanoma, ovarian, breast and prostate [32], while our
panel consists of eight cell lines specifically targeting a
single malignancy, i.e., NSCLC. Our results not only
confirm the presence of the variation in the expression
seen among the 60 cell lines but extend the conclusion
that indeed this heterogeneity and variation also exist at
specific tumor derived cell lines and the three subtypes
of NSCLC.
Our research shows that EpCAM is upregulated in
all NSCLC cell lines. This is not surprising as it has been
speculated elsewhere that proliferation, self-renewal,
and invasiveness of these cells may be facilitated by
the upregulation of EpCAM, leading to its use as a target of immunotherapy and treatment of human carcinoma [15,16].
Detecting EpCAM in circulating tumor cells has provoked considerable interest in cancer therapy and accordingly Food Drug Administration has set the standard for
enriching circulatory tumor cells to capture and measuring the expression of EpCAM in circulating tumor cells
using a magnetic ferrofluid [33]. But since EpCAM is
also expressed heterogeneously in normal epithelial and
in primary cells, combination therapy seems more appropriate for patients. Recently it has also reported that
selected markers including EpCAM have been found to
be present at high levels in the primary tumors while
the level of expression was found to be low or nondetectable in normal lymph nodes or peripheral blood
of NSCLC patients [34].
Our results also confirm an elevated level of activity of
the ALDH in seven out of eight NSCLC cell lines where
75% of squamous cell carcinoma and all the large cells
are positive for the enzyme.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
CD133, a transmembrane glycoprotein, has been reported
to be one of the most representative markers of tumor
initiating cells and in various tumors such as glioblastoma
and colorectal [17,18]. CD133 is also a marker of interest in circulatory tumor cells in malignancies including
NSCLC [35]. In our study, although the entire lung cancer cell line panel expresses a low level of CD133/2, we
do not see any indication that the level of expression
could be an indicative of a prognostic marker in NSCLC.
We further looked at CD24 and CD38 cell surface proteins in the panel. CD24 is a potential biomarker of tumors
[36] and the expression of this glycosylphosphatidylinositolanchored receptor is upregulated in some of the cancers and in NSCLC is consistently associated with
progression and metastasis of the tumors [37]. Our
interest to investigate CD38 in NSCLC started with a
previous finding in our laboratory that the enzyme is
overexpressed in cancer stem cells isolated from a NSCLC
cell line [23].
We observed an upregulation of CD24 in over 75% of
NSCLC patients and for the first time we present conclusive data that 75% of the lung cell lines panel virtually
do not express CD38. Previously we had also shown by
immunofluorescence that the expression of CD38 is
downregulated and CD24 upregulated in human lung
cancer H460 cell line, one of the cell lines in current
study [23]. To our knowledge this is the first report implicating an association between CD38 and NSCLC. Since
a major function of CD38 is the regulation of intercellular
calcium, then the absence or downregulation of the
enzyme in lung cancer cell lines may indicate the
disruption of intercellular calcium pathways in this
disease [25,38]. If combined with CD24, 50% of the
NSCLC cell lines have a CD24+/CD38-/low phenotype
that may qualify this phenotype as a new signature of
NSCLC. Also of interest is the finding that all the
CD24+/CD38-/low cells are CD133, and EpCAM positive. We strongly suggest a larger scale prospective
study to validate these new diagnostic biomarkers and
their correlation with non-small cell lung cancer
patient’s survival.
Availability of supporting data
The data set supporting the results of the present study
is present within the article.
Competing interests
The authors declare no conflict of interests.
Acknowledgements
The authors thank Dr. David Murray for his valuable comments and editing
and Tony Li for his technical assistance. This work was partially supported by
NCI grant R44CA096025 (HF).
Received: 4 April 2013 Accepted: 31 July 2013
Published: 5 October 2013
Page 8 of 9
References
1. Cagle PT, Chirieac LR: Advances in treatment of lung cancer with
targeted therapy. Arch Pathol Lab Med 2012, 136:504–509.
2. Woodward RM, Brown ML, Stewart ST, Cronin KA, Cutler DM: The value
of medical interventions for lung cancer in the elderly: results from
SEER-CMHSF. Cancer 2007, 110:2511–2518.
3. Cipriano LE, Romanus D, Earle CC, Neville BA, Halpern EF, Gazelle GS,
McMahon PM: Lung cancer treatment costs, including patient
responsibility, by disease stage and treatment modality, 1992 to 2003.
Value Health 2011, 14:41–52.
4. Liloglou T, Bediaga NG, Brown BR, Field JK, Davies MP: Epigenetic
biomarkers in lung cancer. Cancer Lett 2012. Apr 27. [Epub ahead of print].
5. Kristiansen G, Schlüns K, Yongwei Y, Denkert C, Dietel M, Petersen I: CD24 is
an independent prognostic marker of survival in nonsmall cell lung
cancer patients. Br J Cancer 2003, 88:231–236.
6. Spiro SG, Tanner NT, Silvestri GA, Janes SM, Lim E, Vansteenkiste JF, Pirker R:
Lung cancer: progress in diagnosis, staging and therapy. Respirology 2010,
15:44–50.
7. Chen HY, Yu SL, Li KC, Yang PC: Biomarkers and transcriptome profiling of
lung cancer. Respirology 2012, 17:620–626.
8. Leng S, Do K, Yingling CM, Picchi MA, Wolf HJ, Kennedy TC, Feser WJ, Baron
AE, Franklin WA, Brock MV, Herman JG, Baylin SB, Byers T, Stidley CA, Belinsky
SA: Defining a gene promoter methylation signature in sputum for lung
cancer risk assessment. Clin Cancer Res 2012, 18:3387–3395.
9. Gámez-Pozo A, Sánchez-Navarro I, Calvo E, Agulló-Ortuño MT, López-Vacas R,
Díaz E, Camafeita E, Nistal M, Madero R, Espinosa E, López JA, Fresno Vara JÁ:
MIF proteins are identified as non-small cell lung cancer biomarkers by
label-free proteomics. PLoS One 2012, 7:e33752.
10. Moreb JS, Zucali JR, Ostmark B, Benson NA: Heterogeneity of aldehyde
dehydrogenase expression in lung cancer cell lines is revealed by
Aldefluor flow cytometry-based assay. Cytometry B Clin Cytom 2007,
72:281–289.
11. Vasiliou V, Pappa A, Petersen DR: Role of aldehyde dehydrogenases in
endogenous and xenobiotic metabolism. Chem Biol Interact 2000,
129:1–19.
12. Moreb JS, Baker HV, Chang LJ, Amaya M, Lopez MC, Ostmark B, Chou W:
ALDH isozymes downregulation affects cell growth, cell motility and
gene expression in lung cancer cells. Mol Cancer 2008, 7:87.
13. Ucar D, Cogle CR, Zucali JR, Ostmark B, Scott EW, Zori R, Gray BA, Moreb JS:
Aldehyde dehydrogenase activity as a functional marker for lung cancer.
Chem Biol Interact 2009, 178:48–55.
14. Pak MG, Shin DH, Lee CH, Lee MK: Significance of EpCAM and TROP2
expression in non-small cell lung cancer. World J Surg Oncol 2012, 6:10–53.
15. van der Gun BT, Melchers LJ, Ruiters MH, de Leij LF, McLaughlin PM, Rots MG:
EpCAM in carcinogenesis: the good, the bad or the ugly. Carcinogenesis
2010, 31:1913–1921.
16. Munz M, Baeuerle PA, Gires O: The emerging role of EpCAM in cancer and
stem cell signaling. Cancer Res 2009, 69:5627–5629.
17. Akunuru S, James Zhai Q, Zheng Y: Non-small cell lung cancer stem/
progenitor cells are enriched in multiple distinct phenotypic
subpopulations and exhibit plasticity. Cell Death Dis 2012, 3:e352.
18. Smith LM, Nesterova A, Ryan MC, Duniho S, Jonas M, Anderson M, Zabinski RF:
CD133/prominin-1 is a potential therapeutic target for antibody-drug
conjugates in hepatocellular and gastric cancers. Br J Cancer 2008, 99:100–109.
19. Woo T, Okudela K, Mitsui H, Yazawa T, Ogawa N, Tajiri M, Yamamoto T, Rino Y,
Kitamura H, Masuda M: Prognostic value of CD133 expression in stage I lung
adenocarcinomas. Int J Clin Exp Pathol 2010, 4:32–42.
20. Kristiansen G, Sammar M, Altevogt P: Tumour biological aspects of CD24,
a mucin-like adhesion molecule. J Mol Histol 2004, 35:255–262.
21. Karimi-Busheri F, Rasouli-Nia A, Mackey JR, Weinfeld M: Senescence evasion
by MCF-7 human breast tumor-initiating cells. Breast Cancer Res 2010, 2:R31.
22. Karimi-Busheri F, Zadorozhny V, Shawler DL, Fakhrai H: The stability of breast
cancer progenitor cells during cryopreservation: maintenance of
proliferation, self-renewal, and senescence characteristics. Cryobiology 2010,
60:308–314.
23. Karimi-Busheri F, Zadorozhny V, Li T, Lin H, Shawler DL, Fakhrai H: Pivotal role of
CD38 biomarker in combination with CD24, EpCAM, and ALDH for
identification of H460 derived lung cancer stem cells. J Stem Cells 2011, 6:9–20.
24. Karimi-Busheri F, Zadorozhny V, Carrier E, Fakhrai H: Molecular integrity and
global gene expression of breast and lung cancer stem cells under
long-term storage and recovery. Cell Tissue Bank 2013, 14:175–186.
Karimi-Busheri et al. Multidisciplinary Respiratory Medicine 2013, 8:65
http://www.mrmjournal.com/content/8/1/65
Page 9 of 9
25. Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, Chiorazzi N: CD38 and
chronic lymphocytic leukemia: a decade later. Blood 2011, 118:3470–3478.
26. Hamblin TJ: CD38: what is it there for? Blood 2003, 102:1939–1940.
27. Jawad M, Yu N, Seedhouse CH, Tandon K, Russell NH, Pallis M: Targeting of
CD34 + CD38- cells using Gemtuzumab Ozogamicin (Mylotarg) in
combination with Tipifarnib (Zarnestra) in Acute Myeloid Leukaemia.
BMC Cancer 2012, 12:431.
28. Dürig J, Naschar M, Schmücker U, Renzing-Köhler K, Hölter T, Hüttmann A,
Dührsen U: CD38 expression is an important prognostic marker in
chronic lymphocytic leukaemia. Leukemia 2002, 16:30–35.
29. Sugarbaker DJ, Dasilva MC: Diagnostic workup of lung cancer. Surg Oncol
Clin N Am 2011, 20:667–679.
30. Gazdar AF, Girard L, Lockwood WW, Lam WL, Minna JD: Lung cancer cell
lines as tools for biomedical discovery and research. J Natl Cancer Inst
2010, 102:1310–1321.
31. Stuelten CH, Mertins SD, Busch JI, Gowens M, Scudiero DA, Burkett MW,
Hite KM, Alley M, Hollingshead M, Shoemaker RH, Niederhuber JE: Complex
display of putative tumor stem cell markers in the NCI60 tumor cell line
panel. Stem Cells 2010, 28:649–660.
32. Shoemaker RH: The NCI60 human tumour cell line anticancer drug
screen. Nat Rev Cancer 2006, 6:813–823.
33. Ni J, Cozzi PJ, Duan W, Shigdar S, Graham PH, John KH, Li Y: Role of the
EpCAM (CD326) in prostate cancer metastasis and progression.
Cancer Metastasis Rev 2012, 31:779–791.
34. Nordgård O, Singh G, Solberg S, Jørgensen L, Halvorsen AR, Smaaland R,
Brustugun OT, Helland A: Novel molecular tumor cell markers in regional
lymph nodes and blood samples from patients undergoing surgery for
non-small cell lung cancer. PLoS One 2013, 8:e62153.
35. Vroling L, Lind JS, de Haas RR, Verheul HM, van Hinsbergh VW, Broxterman HJ,
Smit EF: CD133+ circulating haematopoietic progenitor cells predict for
response to sorafenib plus erlotinib in non-small cell lung cancer patients.
Br J Cancer 2010, 102:268–275.
36. Mierke CT, Bretz N, Altevogt P: Contractile forces contribute to increased
glycosylphosphatidylinositol-anchored receptor CD24-facilitated cancer
cell invasion. J Biol Chem 2011, 286:34858–34871.
37. Lee HJ, Choe G, Jheon S, Sung SW, Lee CT, Chung JH: CD24, a novel
cancer biomarker, predicting disease-free survival of non-small cell lung
carcinomas: a retrospective study of prognostic factor analysis from the
viewpoint of forthcoming (seventh) new TNM classification. J Thorac
Oncol 2010, 5:649–657.
38. Deaglio S, Vaisitti T, Serra S, Audrito V, Bologna C, DAQZAZ’Arena G,
Laurenti L, Gottardi D, Malavasi F: CD38 in chronic lymphocytic leukemia:
from bench to bedside? Mini Rev Med Chem 2011, 11:503–507.
doi:10.1186/2049-6958-8-65
Cite this article as: Karimi-Busheri et al.: CD24+/CD38- as new prognostic
marker for non-small cell lung cancer. Multidisciplinary Respiratory
Medicine 2013 8:65.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
ORIGINAL RESEARCH ARTICLE
Open Access
Pulmonary manifestations in Behçet disease:
impaired natural killer cells activity
Kamel Hamzaoui1*, Anissa Berraies1,2, Wajih Kaabachi1, Jamel Ammar1,2 and Agnès Hamzaoui1,2
Abstract
Background: Behçet’s disease (BD) is a systemic vasculitis with unknown aetiology, where, besides genetic
predisposition, an immune dysregulation involving T and B lymphocytes and hyperactive neutrophils contribute to
disease pathogenesis. The aim of this study was to determine the cytotoxicity of natural killer (NK) cells in
bronchoalveolar lavage (BAL) from BD patients with pulmonary manifestations.
Methods: BAL was performed in 27 patients with BD and pulmonary manifestations, 14 patients with Rheumatoid
Arthritis (RA) and 23 healthy controls (HC). Related orphan receptor C (RORC) and forkheadbox P3 (FOXP3) mRNA
transcript were determined in BAL by reverse transcription–polymerase chain reaction (RT-PCR). NK cells, NK cell
cytotoxicity, and lymphokine-activated killer (LAK) activity against K562 cells were measured by flow cytometry.
Proportions of NK precursors and expression of genes for IL-2 receptor β (IL-2Rβ; CD122), perforin, and granzyme in
NK cells were measured by flow cytometry or RT-PCR.
Results: The analysis of transcription factors revealed an increase in the RORC/FOXP3 ratio (Th17/Treg cells) in BAL
from BD patients. Percentages of NK were significantly lower in BD than in RA patients and healthy controls.
Purified NK cells derived from BD patients were found to have lower cytotoxicity and LAK activity than those from
controls. This defect of NK cells in BD patients was related to down-regulation of perforin and granzyme expression
in NK cells.
Conclusion: In BD patients, the increased RORC/FOXP3 ratio indicated an inflammatory state of the lung. NK cells
were decreased together with an impairment of their activity due to a defective expression of granzyme and
perforin. These abnormalities possibly contribute to immune system dysregulation found in BAL of BD patients with
pulmonary manifestations.
Keywords: Behçet disease, Bronchoalveolar lavage, Granzyme, Inflammation, Natural killer cells, Perforin
Background
Behçet’s disease (BD) is a systemic vasculitis with unknown aetiology. Immune dysregulation involving T and
B cells with hyperactive neutrophils, supposedly triggered
by infectious agents, contribute to disease pathogenesis
in addition to genetic predisposition [1]. Documentation
of various atypical streptococcal species in oral flora of
BD patients, clinical flares after dental procedures and a
good response to antibacterial treatment have been considered as evidence for the role of Streptococcus in BD
[2]. However, none of the microbial agents has been
* Correspondence: [email protected]
1
Department of Basic Sciences, Division of Histology and Immunology,
Medicine School of Tunis, Tunis El Manar University, 15 Rue DjebelLakdar,
1007 Tunis, Tunisia
Full list of author information is available at the end of the article
definitely proved to cause BD. Immunological disorders
are important in BD pathogenesis [3]. T lymphocytes
from patients with BD produced a particular pattern of
inflammatory mediators when stimulated with a bacterial
superantigen, and innate immunity was deeply investigated in BD patients [4].
In Behçet’s disease, vascular system involvement is the
main cause of mortality. Pulmonary artery aneurysms,
arterial and venous thrombosis, pulmonary infarction,
recurrent pneumonia, bronchiolitis obliterans organized
pneumonia, and pleurisy are the main features of pulmonary involvement in BD [5,6]. Inflammatory features
characterize bronchoaveolar lavage (BAL) from BD patients with pulmonary involvement. B cell-activating factor of the TNF family (BAFF), an important regulator of
© 2013 Hamzaoui et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
B-cell survival and immunoglobulin class-switch recombination is increased in BD lung and contributes to immunoglobulin synthesis [7]. Both interleukin 18 (IL-18)
and gamma interferon (IFN-γ), contribute to the local
inflammatory response in BAL from BD patients [8]. Recently Toll-like receptors expressing cells and NOD-like
receptors (NLRs) were found to synergize for the induction of proinflammatory cytokines in BAL from BD patients with pulmonary manifestations [9].
As major components of innate immunity, Natural killer
(NK) cells not only exert cell-mediated cytotoxicity against
tumour or infected cells, but also regulate other immune
cells functions by secretion of cytokines and chemokines.
Due to these effector functions, NK cells play a significant
role in host defense against malignancies and certain viruses and they may also be important in the regulation of
autoimmunity [10]. However, the effector function of NK
cells must be exquisitely controlled in order to prevent inadvertent attack against self normal cells. Patients with active BD show impaired NK cytotoxicity [11-14]. Impaired
NK cytotoxicity in first-degree relatives of BD patients was
recently reported [14-16], which suggests that NK cell deficiency, may be a genetic determinant of BD.
The aim of the present study was to determine the expression of retinoid-related orphan receptor C (RORC)
(Th17), forkheadbox P3 (FOXP3) (Treg) and the cytotoxicity of pulmonary NK cells in BD. We determined NK cell
levels, NK cytotoxicity, and lymphokine-activated killer
(LAK) activity in BAL of patients with BD. Proportions of
NK precursors and expression of genes for IL-2 receptor
β-chain (IL-2Rβ; CD122), perforin, and granzyme in
NK cells were measured by flow cytometry or reverse
transcription–polymerase chain reaction (RT-PCR).
Methods
Patients
The study group consisted of 27 BD patients (19 males,
8 females, age 34 ± 10 years; range 17–56 years) all fulfilling the international study group criteria for Behcet’s
disease [17], with a disease duration ranging from 1 to
9 years (mean ± SD: 5.8 ± 3.4). Twenty three BD patients were never-smokers and 4 ex-smokers. All patients had active BD with pulmonary manifestations
[8,9] including eye lesions (14 patients: 51.85%), oral ulcers (27 patients: 100%) , genital ulcers (18 patients:
66.67%), arthritis (16 patients: 59.25%), and vascular
symptoms (12 patients: 44.45%). Pulmonary vascular
abnormalities were as follows: asymptomatic functional
abnormalities (8 patients), pulmonary artery aneurysm
(6 patients), pulmonary artery embolism (9 patients), and
pulmonary venous abnormalities (4 patients). They were
treated with steroids and colchicine. Remission was defined when clinical manifestations were lost (eye lesions,
oral and genital ulcers, and arthritis). Asymptomatic
Page 2 of 8
functional abnormalities diminished after corticosteroid
treatment. Rheumatoid arthritis patients (RA: 10 men
and 4 women; mean age: 46.2 ± 9.5 years; range: 42–50
years) acted as control disease. The control subjects
consisted of 23 non-smokers (18 men and 5 women;
mean age: 42.8 ± 7 years; range: 38–52 years) undergoing
routine investigations for suspected bronchial carcinoma
and whose chest X-ray, bronchial examination, and pulmonary function were normal. None of them had evidence of acute infection or chronic disease (e.g., other
autoimmune or atopic disorders). Our hospital ethic
committee approved the design of the study and BAL
was obtained after informed consent.
Monoclonal antibodies (mAb) and flow cytometry
The following mAb and reagents were used in this
study: fluorescein isothiocyanate (FITC)–conjugated
or peridinin chlorophyll A protein–conjugated antiCD3 mAb, FITC-conjugated anti-CD45 mAb, FITCconjugated or phycoerythrin (PE)–conjugated anti-CD56
mAb, PE-conjugated anti-CD16 mAb, PE-conjugated
anti-CD122 mAb, and FITC-conjugated antiperforinmAb
(all from Becton Dickinson, San Diego, CA). Cells were
stained with combinations of appropriate mAb at 4°C for
20 minutes. Stained cells were analyzed on a FACsCalibur
flow cytometer using Cell Quest software (BD Biosciences,
Mountain View, CA).
Bronchoalveolar lavage
BAL was obtained as we previously reported [9]. Briefly,
bronchoscopy was performed according to standard
guidelines [18]. Thirty minutes prior to the procedure
patients received 0.5 mg of atropine and 12.5 mg codeine intramuscularly. Local anaesthesia of the oropharynx was achieved by xylocaine instillation until gag
reflexes subsided. Bronchoscopy was performed using a
Pentax bronchoscope through which 150 ml of normal
prewarmed saline in aliquots of 50 ml were instilled into
a subsegment of the right middle lobe. BAL fluid (BALF)
was then immediately aspirated by gentle hand suction
into plastic tubes and kept at 4°C on ice.
BALF was concentrated 10 fold before analysis whilst a
great part of the cell pellets were immediately fixed in
RNA stabilisation buffer. The total count of nucleated cells
was performed as we have recently reported [9]. Differential cell count was determined by cytological examination
of at least 500 cells after centrifugation in a cytospin
(Shandon) and May-Grünwald-Giemsa staining. Cell percentages were recorded for every patient. The rest of BALF
was centrifuged at 400 g for 10 min and the pellet was
processed for lymphocyte subset of (Th17) and regulatory
T cells (Treg) determination. All BALF were analyzed at
the time of processing and only technically appropriate
BALF were retrospectively reviewed.
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
Flow cytometric assays of the cytotoxicities of BAL cells
and purified NK cells
BAL cells and BAL-isolated NK cells were used as effector
cells and were cultured for 4 hours at 37°C in complete
media, consisting of RPMI 1640, 2 mM-glutamine,
100 units/ml of penicillin, 100 μg/ml of streptomycin,
and supplemented with 10% fetal bovine serum (FBS;
Gibco BRL, Grand Island, NY) in a humidified incubator containing 5% CO2. K562 cells (CCL-243; American
Type Culture Collection, Manassas, VA) were used as
target cells. Effector and target cells were mixed in 12 ×
75–mm round-bottomed polystyrene tubes (Becton
Dickinson) at different effector-to-target (E:T) cell ratios. Control tubes including only target cells were also
assayed to quantify spontaneous K562 cell death. Tubes
were incubated for 4 hours at 37°C in a humidified incubator containing 5% CO2.
To determine LAK activities, 200 IU/ml of recombinant IL-2 (BD PharMingen, San Jose, CA) was added to
the tubes. Mixed effector and target cells were stained
with FITC-conjugated anti-CD45 mAb at 4°C for 20 minutes, washed once in phosphate buffered saline (PBS),
resuspended in 0.5 ml of PBS containing 20 μl of 1 μg/ml
propidium iodide (BD PharMingen), and incubated at
room temperature for 15 minutes. Percentages of dead
K562 cells were determined by flow cytometry. Cytotoxicities were calculated by subtracting the percentages of
dead K562 cells in control tubes from the percentages of
dead cells in sample tubes.
RT-PCR
Total cellular RNA was extracted from isolated BAL
cells and NK cells using RNAzol B (Tel-Test, Friendswood, TX), according to the manufacturer’s instructions. Aliquots (3 μg) of total cellular RNA were
transcribed into complementary DNA (cDNA) at 37°C
for 1 hour in a total volume of 20 μl using 2.5 units of
Moloney murine leukemia virus reverse transcriptase
(Roche, Germany). Reverse-transcribed cDNA samples
were then added to a PCR mixture consisting of 10×
PCR buffer, 0.2 mMdNTPs, 0.5 units of Taq DNA polymerase (Biocare Lab, Tunisia), and 10 pmoles of
primers for each gene. The sequences of the primers
we used were as follows: for β-actin, 50-CTCCTTA
ATGTCACGCACGAT-30 (sense) and 50-GTGGGGCG
CCCCAG GCACCA-30 (antisense); for perforin, 50CTGCCGTGGATGCCTATG-30 (sense) and 50-CGGC
TCACACTCACAGG-30 (antisense); for granzyme, 50TACACACAAGA GCTCCAGAGT-30 (sense) and 50GGGGAAGCTCCATAAATGTCACCT-30 (antisense);
for CD122, 50-GGTCACCTGATAGTGGAGAA-30 (sense)
and 50-ACCTGAATCCAATTTCACAG-30 (antisense); for
c-Kit, 50-TTCTTACCAGGTGG CAAAGGGCATGGCT
TTCC-30 (sense) and 50-GTCATACATTTCAGCAGGT
Page 3 of 8
GCGTG TTCAGGGC-30 (antisense); and for Flt-3, 50GAGGACTTGAATGTGCTTACA-30 (sense) and 50-TCC
CACAGTAATATTCCATATGA-30 (antisense).
Amplifications were conducted over 28 cycles of 94°C
for 1 minute (denaturation), 55°C for 1 minute (annealing),
and 72°C for 1 minute (extension). This was followed by
an additional extension step at 72°C for 10 minutes in a
PCR cycler (Bio-Rad, CA). PCR products were subjected to
electrophoresis and visualized by ethidium bromide staining. Densities were analyzed versus β-actin by densitometry
using Alpha Ease FC image analysis software (Alpha
Innotech, CA). Results are presented as relative gene expression intensities.
Quantification of RORC/FOXP3 (Th17/Treg) ratios
The expression of mRNA for FOXP3 (Treg) and RORC
(Th17) was quantified using the Applied Biosystems
7500 Fast Real-Time PCR System (Applied Biosystems,
Foster City, CA, USA) as we have recently reported
[9,12]. Amplification of cDNA was performed with the
TaqMan Universal PCR Master Mix (2×), No AmpErase
UNG (Applied Biosystems). A reaction volume of 25 μl
(1.0 μlcDNA) was amplified for 40 cycles of 10s at 95°C
and 1 min at 60°C. All samples were analyzed in duplicate, and transcription expression was calculated as a
mean and standard deviation (SD). For quantification of
cDNA a five-point serially four-fold diluted standard
curve was developed from BAL cell cultures stimulated
with phytohaemagglutinin (PHA). The mRNA expression of the T cell transcription factors was standardized
to 18S (human rRNA) and all results are expressed as a
ratio. A coefficient of variance < 15% was accepted as
maximum variation among duplicates. The intra-assay
variance for 18S was 4.9%, FOXP3 6.1%, RORC 6.2%.
Samples revealing an undetectable expression in both
duplicates in three subsequent analyses were assigned an
expression quantity of zero. Primers and probes for
FOXP3 forward GTGGCCCG GATGTG AGAA, reverse
GCTGCTCCAG AGACTGTACCATCT, probe CCTCAA
GCACTGCCAGGCGGAC; 18S forward CGGCTACCA
CATCCA AGGAA, reverse GCTGGAATTACCGCGGCT,
probe GAGGGCAAGTCTGGTGCCA GCA. HPLCpurified oligonucleotide primers and probes were
bought from MedProbe (Oslo, Norway). All in-house
designed mRNA amplicons included at least one exon–
exon boundary to assure specificity (marked in bold in
the sequences above), and reaction concentration was
optimized prior to analysis of samples.
Statistical analysis
The percentages of NK cells were log-transformed for
purposes of analysis. All comparisons of percentages of
NK cells and of cytotoxicity were made by analysis of
covariance after adjusting for age and sex using the
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
Page 4 of 8
Bonferroni correction for multiple comparisons. Comparisons of CD3–CD122+ cell percentages and of CD122 surface expression rates among NK cells were made by
analysis of variance with the Bonferroni correction for
multiple comparisons. P less than 0.05 was considered statistically significant. All statistical analyses were performed
using SPSS version 14.0 software (SPSS, Chicago, IL).
Results
Cell analyses and Th17/Treg ratio in bronchoalveolar
lavage
BAL fluids recovered from BD patients were more cellular than those from healthy controls and RA patients ,
containing significantly greater number of lymphocytes
(P< 0.05) [Table 1]. Expression of retinoid-related orphan receptor C (RORC) (Th17) and forkhead box P3
(FOXP3) (Treg) mRNA transcript were studied in BAL
cells from 27 BD patients with pulmonary manifestations, 14 RA patients and 23 healthy controls. FOXP3
was expressed at similar levels between BD patients
[1.62 ± 0.60%], RA patients [1.58 ± 0.44%] and healthy
controls [1.67 ± 0.59%; P = 0.85 and P = 0.77]. In contrast, RORC was highly expressed in BAL of BD patients
[1.93 ± 0.69%] compared to that of RA patients [0.76 ±
0.22%; P = 0.0001] and of healthy controls [0.85 ±
0.38%; P = 0.0001]. Th17/Treg (RORC/FOXP3) ratio
was increased in BD patients contrasting with values observed in RA patients and in healthy controls (Figure 1).
Figure 1 Transcription factor ratios in BAL cells. Values were
expressed as mean ± SD in the text. P is indicated in the Figure.
Data are shown as box plots. Each box represents the 25th to 75th
percentiles. Lines inside the boxes represent the mean. Whiskers
represent the 10th and the 90th percentiles.
evaluated by flow cytometry and determined at an effector/
target (E:T) cell ratio of 10:1, 5:1 and 2.5:1. The cytotoxicities were significantly lower in BD compared to NK activity in RA patients and in healthy controls (Figure 3A).
Several groups of investigators suggested that NK
cytotoxicity was enhanced by IL-2 [19]. LAK activity induced by IL-2 was significantly lower in BD and RA
Reduced numbers of circulating NK cells in BAL cells from
BD patients
The percentages of NK cells in the BAL of BD patients,
RA patients and healthy controls were determined by
flow cytometry. NK cell percentages were significantly
lower in BD patients [5.59% ± 2.22%], than in healthy
controls [12.60% ± 2.36%; P = 0.0001]. NK cells in RA
patients [10.50% ± 2.69%] were expressed at higher level
than in BD patients [P = 0.0001]. Low and significant
difference was found between RA and healthy controls
[P = 0.017] (Figure 2).
Impaired cytotoxicity of BAL NK cells in BD patients
To examine the cytotoxic effects of NK cells on K562 cells,
BAL from 27 BD patients, 14 RA patients, and 23 healthy
controls were used. The cytotoxicities of BAL cells were
Table 1 Differential cell count
Diseases
Macrophages Lymphocytes Neutrophils Eosinophils
†
BD (n = 27) 72.5 ± 7.4
19.7 ± 4.3
7.6 ± 10.9
1.9 ± 4.3
RA (n = 14) 72.6 ± 5,8
14.8 ± 9.7
10.3 ± 11.9
2.4 ± 3.6
HC (n = 23) 78 ± 6.8
12.5 ± 3.4
3.5 ± 1.4
0.5 ± 0.7
BD, Behçet’s disease; HC, Healthy control, RA, rheumatoidarthritis. Values are
presented as mean) ± SD. (†): Significance Behçet’s disease versus control
subjects and RA patients (P = 0.001).
Figure 2 Reduced numbers of NK cells in BAL of Behçet’s disease.
Freshly isolated bronchoalveolar cells from healthy controls, Rheumatoid
arthritis patients and BD patients were stained with fluorescein
isothiocyanate–conjugated anti-CD3 and phycoerythrin-conjugated
anti-CD56 monoclonal antibodies and then analyzed by flow cytometry.
Data are shown as box plots. Each box represents the 25th to 75th
percentiles. Lines inside the boxes represent the mean. Whiskers
represent the 10th and the 90th percentiles.
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
Page 5 of 8
Figure 3 Decreased cytotoxicity of bronchoalveolar lavage cells from Behçet’s disease patients. Freshly isolated BAL cells were stained
with fluorescein isothiocyanate–conjugated anti-CD45 monoclonal antibody and then cocultured with K562 cells kine for 4 hours. Cytotoxicity
was determined as described in patients and methods and is expressed as the percentage of apoptotic K562 cells. For measurement of
lymphokine-activated killer (LAK) activity, interleukin-2 (IL-2; 200 IU/ml) was added to cocultures. Cytotoxicity [A] and LAK activity [B] were
determined in BAL cells from 23 healthy controls (HC), 14 patients with RA and 27 patients with Behçet’s disease (BD). Data are Mean ± SD.
Cytotoxicity was determined at an effector-to-target (E:T) cell ratio of 10:1, 5:1 and 2.5: 1.
patients than in healthy controls (Figure 3B). Cytotoxicities of BAL cells were significantly correlated with NK
cell percentages [NK activity: r = 0.590; P = 0.0012].
These findings suggest that impaired cytotoxicity of BAL
cells is caused by an NK cell deficiency. Cytotoxicities in
BAL from healthy controls were greater at higher E:T
cell ratios. This was also the case in BAL from BD and
RA patients.
Intrinsic defects of NK cells in BD patients
To examine whether defective killing by NK cells contributes to the impaired cytotoxicity observed in BD patients, we compared the cytotoxicities of purified NK
cells obtained from the BAL of 10 BD patients, 7 RA patients and 10 BAL from healthy controls. The cytotoxicities of purified NK cells were determined at an E:T cell
ratio of 10/1, 5:1 and 2.5:1. We found that cytotoxicities
and LAK activities were significantly lower in BD patients than in healthy controls. These values were significantly lower in RA patients than in healthy controls
(Figures 4A and B). Cytotoxicities and LAK activities increased in healthy controls and RA patients when E:T
cell ratios increased, which contrasted in BD patients.
These results suggest that killing deficits of NK cells
contribute to impaired cytotoxicity and LAK activity in
BAL from BD patients.
The expression of IL-2 receptor β-chain (IL-2Rβ,
CD122) is important for the differentiation of NK
cells. CD122 is regarded as a marker for NK precursors. CD3+CD122+ cells include immature and mature
NK cells as reported by Huntington et al. [20]. We investigated the proportions of CD3+CD122+ cells in
BAL cells and IL-2Rβ-expressing cells in NK cells.
The percentages of CD3+CD122+ cells and of CD122
expression on NK cells were significantly lower in BD
patients [CD3+CD122+: 5.32 ± 1.92%, P = 0.0001;
CD122-NK cells: 60.70 ± 13.70, P = 0.0001] than in RA patients [CD3+CD122+: 18.50 ± 3.27%; CD122-NK cells:
92.83 ± 10.11%] and in healthy controls [CD3+CD122+:
15.10 ± 3.70%; CD122-NK cells: 84.80 ± 7.68%;]. No differences were observed between RA patients and healthy
controls [CD3+CD122+: P = 0.085; P = 0.093] (Figures 5A
and B). We also examined the expression levels of
CD122 and of the toxicity-related molecules perforin and
granzyme in BAL cells and purified NK cells. Gene transcripts of CD122, perforin, and granzyme were found to
be markedly lower in BAL cells and NK cells from BD
patients (Figure 5C). Intracellular perforin expression in
NK cells was also lower in BD patients than in RA patients and in healthy controls (Figure 5D).
Discussion
The results of this study demonstrated that BAL cells
from BD patients display an inflammatory profile associated with an impairment of NK activity.
The number of Treg cells (FOXP3) was unaltered in
BD patients compared to controls, contrasting with an
increase in Th17 (RORC) subpopulation. These results
suggest that an imbalance of Th17/Treg in BAL cells
may be implicated in the pathogenesis of lung involvement in BD. Increased expression of IL-17 in inflammatory sites supports a Th17-mediated inflammatory
pathway in several diseases [21-24].
In the present study, we found that NK cell number
and cytotoxicity were decreased in BAL from BD patients
with pulmonary involvement compared to RA patients
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
Page 6 of 8
Figure 4 Decreased cytotoxicity of purified natural killer cells from Behçet’s disease patients. NK cells were isolated from BAL cells by
magnetic-activated cell sorting. Cytotoxicity and lymphokine-activated killer activity were determined as described in Figure 3. Cytotoxicity [A] and
LAK activity [B] of purified NK cells were determined in 5 healthy controls, 3 patients with RA and 7 patients with Behçet’s Disease. Data are shown
as box plots. Each box represents the 25th to 75th percentiles. Lines inside the boxes represent the mean. Whiskers represent the 10th and the 90th
percentiles. Cytotoxicity was determined at an effector-to-target (E:T) cell ratio of 10:1, 5:1 and 2.5:1.
and healthy controls. NK cells represent an important
population of effector cytotoxic lymphocytes and a major
source of pro-inflammatory cytokines. CD3+CD122+ cell,
which include immature and mature NK cells [20], were
reduced in BAL from BD patients. Cytotoxicity of BAL
purified NK cells were markedly suppressed in BD patients. This activity was not diminished in RA patients.
Reduction of cytotoxicity in BD patients resulted from a
lowered NK cell number associated with an intrinsic NK
cell defect of granzyme expression. This is demonstrated
by down-regulation of IL-2Rβ, perforin, and granzyme in
NK cells in our patients.
NK cell numbers and activities were persistently low.
These data contrast with reported results on peripheral
circulation in BD patients, showing increased NK population and high NK activity [11]. This could raise the
question of whether local reductions in NK cell number
and activity are a consequence of a defective differentiation of hematopoietic stem cells into NK cells, as recently described by Park et al. in systemic lupus patients
[11]. This point has to be investigated in a future report.
Intensity and quality of the NK cell cytotoxic response
depend on the cytokine microenvironment as well as on
immune system interactions [25,26]. These interactions include crosstalk between NK cells and dendritic cells (DCs)
or T lymphocytes, occurring initially in secondary compartments such as lymph nodes [27]. The phenotyping and
functional results from the present study are partially consistent with these findings.
The reduced cytotoxicity in BAL from BD was merely
due to low perforin expression. Resting CD56dim NK
cells, which account for the majority of circulating NK
cells, express intermediate-affinity IL-2Rβ, mediates the
induction of LAK activity [28]. In mature NK cells,
IL-2Rβ is shared by IL-2 and IL-15, and IL-15 can efficiently induce NK cell proliferation, differentiation, and activation, which markedly increases NK cytotoxicity.
However, adjunction of IL-2 to BD NK cells yielded a reduced increase of cytotoxicity compared to controls. This
lowered effect of IL-2 on LAK activity in BD is associated
with a decrease in IL-2Rβ expression. As IL-2Rβ is critical
for LAK activity and NK cell differentiation, down regulation of IL-2Rβ in NK cells from BD patients is consistent
with the reduced response of NK cells to IL-2.
A possible explanation is that NK cell depletion in
the BD lung patients occurs secondary to disease progression and to the localized important inflammation
existing in the lung. However, our present findings suggest that numerical deficiencies and functional defects
of NK cells might play an active role in the pathogenesis
of BD, rather than being a consequence of the disease
process. Indeed, it has been reported that NK cells may
control disease flare/remission in BD patients via NK
type 2-mediated modulation of the Th1 response [29].
A possible interaction exists between the increased
Th17 and the paucity of NK cells. NK cells are able to
down-regulate Th17 cell responses to avoid pathologic
autoimmunity. In T-bet-/-mice, the paucity of NK and
Natural killer T (NKT) cells contributes to a highly polarized Th17 phenotype [30]. Wu et al. [31] demonstrated
that addition of NK cells could inhibit T-bet-deficient,
autoreactive Th17 cells in the peripheral immune system.
These findings have important implications for the development of Th17 cell-mediated autoimmune pathology
and suggest a potential role of NK cells in modulation of
Th17 cell-mediated autoimmunity. In the lungs of BD
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
Page 7 of 8
Figure 5 Reduced expression of CD122 (interleukin-2 receptor β [IL-2Rβ]), perforin, and granzyme in bronchoalveolar lavage from
Behçet’s disease patients. [A]: Percentages of CD3+CD122+ cells in BAL. [B] Percentages of IL-2Rβ–expressing cells in natural killer cells from 10
healthy controls 10 patients with BD, and 7 patients with rheumatoid arthritis . Freshly isolated BAL cells were stained with peridinin chlorophyll
A protein–conjugated anti-CD3, fluorescein isothiocyanate–conjugated anti-CD56, and phycoerythrin-conjugated anti-CD122 monoclonal
antibodies and then analyzed by flow cytometry. Data are shown as box plots. Each box represents the 25th to 75th percentiles. Lines inside the
boxes represent the mean. Whiskers represent the 10th and the 90th percentiles. [C]: Expression of mRNA for CD122 (IL-2Rβ), perforin, and
granzyme in BAL cells and purified NK cells from a healthy control subject and a patient with BD. Total RNA was extracted, reverse-transcribed,
and amplified by polymerase chain reaction using primers specific for CD122, perforin, granzyme, and β-actin. PCR products were separated by
electrophoresis on 1.0% agarose gels. [D]: Perforin expression in NK cells from a healthy control subject and a patient with BD, as determined by
intracellular flow cytometry. Shaded regions represent anti-perforin monoclonal antibody (mAb); open regions represent isotype-matched control
monoclonal antibody (mAb). Histograms show the CD3+CD56+ cell population. Results are representative of 3 independent experiments.
Hamzaoui et al. Multidisciplinary Respiratory Medicine 2013, 8:29
http://www.mrmjournal.com/content/8/1/29
patients the paucity of NK cells is associated with a high
Th17 expression. The question remains about IL-17
effect on NK cells.
Page 8 of 8
12.
Conclusions
Pulmonary manifestations are seen in approximately 25–
30% of BD patients and represent the first cause of mortality. Our phenotypic and functional findings suggested
that BAL-NK cells from BD patients could have an impaired differentiation. Despite the increasing NK cells in
peripheral circulation, which contrasted with failing NK
cell activity in the lung, a body of research on inflammatory mechanisms in pulmonary manifestations has to be
done. It is still uncertain whether the NK cell in the lung
is friend or foe.
15.
Competing interest
The authors have no conflicts of interest to disclose.
18.
Authors’ contributions
AH, AB, WK and KH, participated in the design and coordination of the study
and to manuscript writing, performed the experiments and analyzed the
data. JA participated in the design, coordination of the study and analyzed
the data. All authors read and approved the final manuscript.
19.
Author details
1
Department of Basic Sciences, Division of Histology and Immunology,
Medicine School of Tunis, Tunis El Manar University, 15 Rue DjebelLakdar,
1007 Tunis, Tunisia. 2Department of respiratory diseases and the Unit
Research “Homeostasis and Cell dysfunction (99/08-40), Division of
Pulmonology, Tunis El Manar University and A. Mami Hospital, Ariana, Tunisia.
Received: 13 November 2012 Accepted: 28 February 2013
Published: 4 April 2013
References
1. Mumcu G, Inanc N, Yavuz S, Direskeneli H: The role of infectious agents in
the pathogenesis, clinical manifestations and treatment strategies in
Behcet’s disease. ClinExpRheumatol 2007, 25:S27–S33.
2. Lehner T, Lavery E, Smith R, Van der-Zee R, Mizushima Y, Shinnick T:
Association between the 65 kDa heat shock protein, Streptoccocussanguis
and the corresponding antibodies in Behcet’s syndrome. Infect Immun 1991,
59:1434–1441.
3. Hamzaoui K, Hamzaoui A: Immunological responses in patients with
behçets disease: advances in understanding. Expert Rev Ophthalmol 2012,
7(3):261–270.
4. Pay S, Simşek I, Erdem H, Dinç A: Immunopathogenesis of Behçet’s
disease with special emphasize on the possible role of antigen
presenting cells. RheumatolInt 2007, 27:417–424.
5. Ozkaya S, Sengul B, Hamsici S, Findik S, Sahin U, Gumus A, Cinarka H: Right
sided arcus aorta as a cause of dyspnea and chronic cough. Multidiscip
Respir Med 2012, 7(1):37.
6. Yılmaz S, Cimen KA: Pulmonary artery aneurysms in Behçet’s disease.
RheumatolInt 2010, 30:1401–1403.
7. Hamzaoui A, Haj Sassi F, Hamzaoui K: Release of B cell-activating factor of
the TNF family in bronchoalveolar lavage from Behçet’s disease with
pulmonary involvement. Oxid Med Cell Longev 2010, 3(2):122–128.
8. Hamzaoui A, Ghraïri H, Ammar J, Zekri S, Guemira F, Hamzaoui K: IL-18
mRNA expression and IFN-gamma induction in bronchoalveolar lavage
from Behçet’s disease. Clin Exp Rheumatol 2003, 21(4 Suppl 30):S8–S14.
9. Hamzaoui K, Abid H, Berraies A, Ammar J, Hamzaoui A: NOD2 is highly
expressed in Behçet disease with pulmonary manifestations. J Inflamm
(Lond) 2012, 13(1):3.
10. Tian Z, Gershwin ME, Zhang C: Regulatory NK cells in autoimmune disease.
J Autoimmun 2012, 39(3):206–215.
11. Park YW, Kee SJ, Cho YN, Lee EH, Lee HY, Kim EM, Shin MH, Park JJ, Kim TJ,
Lee SS, Yoo DH, Kang HS: Impaired differentiation and cytotoxicity of
13.
14.
16.
17.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
natural killer cells in systemic lupus erythematosus. Arthritis Rheum 2009,
60(6):1753–1763.
Hamzaoui K, Kamoun M, Houman H, Hentati F, Hamza M, Ayed K, Hamzaoui A:
Discrepancies of NKT cells expression in peripheral blood and in
cerebrospinal fluid from Behçet’s disease. J Neuroimmunol 2006,
175(1–2):160–168.
Ahn JK, Chung H, Lee DS, Yu YS, Yu HG: CD8brightCD56+T cells are cytotoxic
effectors in patients with active Behcet’s uveitis. J Immunol 2005,
175:6133–6142.
Kibaroglu A, Eksioglu-Demiralp E, Akoglu T, Direskeneli H: T and NK cell
subset changes with microbial extracts and human HSP60-derived peptides
in Behçet’s disease. Clin Exp Rheumatol 2004, 22(4 Suppl 34):S59–S63.
Arayssi TK, El Hajj N, Shamseddine W, Ibrahim G, Nasr J, Sabbagh AS, Greige L,
Zaatari GS, Mahfouz RA: Killer cell immunoglobulin-like receptor genotypes
in Behçet’s disease patients: any role for the 3DP1*001/002 pseudogene?
Genet Test Mol Biomarkers 2009, 13(3):319–324.
Seo J, Park JS, Nam JH, Bang D, Sohn S, Lee ES, Park KS: Association of
CD94/NKG2A, CD94/NKG2C, and its ligand HLA-E polymorphisms with
Behcet’s disease. Tissue Antigens 2007, 70(4):307–313.
International study group for Behcet’s disease: Criteria for diagnosis of
Behcet’s disease. Lancet 1990, 335:1078–1080.
American Thoracic Society, European Respiratory Society and World
Association of Sarcoidosis and Other Granulomatous Disorders: Joint
statement on sarcoidosis. Am J Respir Crit Care Med 1999, 160:736–755.
Lee SH, Fragoso MF, Biron CA: Cutting edge: a novel mechanism bridging
innate and adaptive immunity: IL-12 induction of CD25 to form highaffinity IL-2 receptors on NK cells. J Immunol 2012, 189(6):2712–2716.
Huntington ND, Vosshenrich CA, Di Santo JP: Developmental pathways
that generate natural-killer-cell diversity in mice and humans. Nat Rev
Immunol 2007, 7:703–714.
Cañete JD, Celis R, Noordenbos T, Moll C, Gómez-Puerta JA, Pizcueta P,
Palacin A, Tak PP, Sanmartí R, Baeten D: Distinct synovial immunopathology in
Behçet disease and psoriatic arthritis. Arthritis Res Ther 2009, 11:R17.
Ekinci NS, Alpsoy E, Karakas AA, Yilmaz SB, Yegin O: IL-17A has an important
role in the acute attacks of Behçet’s disease. J Invest Dermatol 2010,
130:2136–2138.
Usui Y, Takeuchi M, Yamakawa N, Takeuchi A, Kezuka T, Ma J, Matsuda R,
Okunuki Y, Akiba H, Goto H: Expression and function of inducible costimulator
on peripheral blood CD4+ T cells in Behçet’s patients with uveitis: a new
activity marker? Invest Ophthalmol Vis Sci 2010, 51:5099–5104.
Saruhan-Direskeneli G, Yentür SP, Akman-Demir G, Işik N, Serdaroğlu P:
Cytokines and chemokines in neuro-Behçet’s disease compared to
multiple sclerosis and other neurological diseases. J Neuroimmunol 2003,
145:127–134.
Roth C, Rothlin C, Riou S, Raulet DH, Lemke G: Stromal-cell regulation of
natural killer cell differentiation. J Mol Med 2007, 85:1047–1056.
Lucas M, Schachterle W, Oberle K, Aichele P, Diefenbach A: Dendritic cells
prime natural killer cells by trans-presenting interleukin 15. Immunity 2007,
26:503–517.
Ferlazzo G, Pack M, Thomas D, Paludan C, Schmid D, Strowig T, Bougras G,
Muller WA, Moretta L, Münz C: Distinct roles of IL-12 and IL-15 in human
natural killer cell activation by dendritic cells from secondary lymphoid
organs. Proc Natl Acad Sci U S A 2004, 101:16606–16611.
Siegel JP, Sharon M, Smith PL, Leonard WJ: The IL-2 receptor β chain (p70):
role in mediating signals for LAK, NK, and proliferative activities. Science 1987,
238:75–78.
Yamaguchi Y, Takahashi H, Satoh T, Okazaki Y, Mizuki N, Takahashi K,
Ikezawa Z, Kuwana M: Natural killer cells control a T-helper 1 response in
patients with Behçet’s disease. Arthritis Res Ther 2010, 12(3):R80.
Townsend MJ, Weinmann AS, Matsuda JL, et al: T-bet regulates the terminal
maturation and homeostasis of NK and Valpha14i NKT cells. Immunity 2004,
20:477–494.
Wu W, Shi S, Ljunggren HG, Cava AL, Van Kaer L, Shi FD, Liu R: NK cells
inhibit T-bet-deficient, autoreactive Th17 cells. Scand J Immunol 2012,
76(6):559–566.
doi:10.1186/2049-6958-8-29
Cite this article as: Hamzaoui et al.: Pulmonary manifestations in Behçet
disease: impaired natural killer cells activity. Multidisciplinary Respiratory
Medicine 2013 8:29.
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
REVIEW
Open Access
The lungs need to be deflated: effects of
glycopyrronium on lung hyperinflation in
COPD patients
Claudio M Sanguinetti1,2
Abstract
Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation caused by bronchial
alterations, small airways disease and parenchymal destruction. In patients with COPD the structural and functional
lung alterations can progress more or less rapidly from the initial small airways disease to an overt COPD where a
severe expiratory flow limitation takes place. In these conditions, lung hyperinflation develops characterized by
increase in functional residual capacity (FRC) and decrease in inspiratory capacity (IC). Thus, IC is an easy and
reliable index to monitor lung hyperinflation and to assess the efficacy of bronchodilator drugs. When FRC
increases, tidal volume (VT) is located in a more flatted upper part of the P –V curve of the respiratory system and
respiratory muscles must sustain a greater elastic workload. Furthermore, due to inadequate time for expiration,
there is a positive alveolar pressure at the end of expiration (PEEPi). This represents a further elastic workload for the
inspiratory muscles. This impairment of ventilatory mechanics generates dyspnea that in most severely compromised
patients occurs also for small efforts causing activity limitation and worst health-related quality of life (HRQoL). Due
to these respiratory alterations, bronchodilators are the cornerstone of the long-term treatment of COPD in order to
decrease airways resistances, lung hyperinflation and exacerbation rate, and improve patient’s symptoms, exercise
tolerance and health status. Long-acting antimuscarinic bronchodilators (LAMAs) have proven to be very useful in
terms of lung deflation and exercise tolerance. Recently, new LAMAs with several positive characteristics have been
introduced into clinical use among which glycopyrronium bromide has shown to be particularly effective.
Glycopyrronium has a longer-lasting effect compared to other anticholinergic drugs, therefore it allows a single
daily administration and facilitates the therapy of a disease that needs a chronic bronchodilation by decreasing the
mechanic stress of the airways determined by repeated bronchoconstriction and increasing patient’s adherence to
treatment plan with better clinical results. Several studies demonstrated that glycopyrronium is able to positively
and significantly decrease lung hyperinflation, symptoms, and improve psycho-physical status of COPD patients,
with a low rate of adverse events, similar to that of placebo.
Keywords: Bronchodilators, COPD, Dyspnea, Glycopyrronium bromide, Inspiratory capacity, Lung hyperinflation
Review
Chronic obstructive pulmonary disease (COPD) is a pathological respiratory condition characterized by persistent
airflow limitation caused in various measures by bronchial
alterations (chronic bronchitis), small airways disease
and parenchymal destruction (pulmonary emphysema).
Correspondence: [email protected]
1
Consultant Respiratory Medicine, Quisisana Clinical Center, Via G. Porro 5,
Rome 00197, Italy
2
Previously Director, Pneumology and Respiratory Intensive Care Unit, San
Filippo Neri General Hospital, Rome, Italy
The disease is determined by a chronic abnormal response
to noxious inhaled substances, mainly tobacco smoke,
presents with persistent cough, sputum production, dyspnea and decreased exercise tolerance, and is associated
with various complications and comorbidities, especially
cardiovascular and metabolic [1-3]. COPD charges a
relevant social and economic burden, affecting almost
4.5% of population in Italy [1]. The main symptom of
COPD is dyspnea and the patients reduce their daily
activities in an attempt to relieve this symptom; but by
avoiding the physical activity patient enters a vicious
© 2014 Sanguinetti; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
circle which leads to deconditioning and having more
dyspnea.
This article addresses the respiratory alterations occurring in COPD that lead to lung hyperinflation and dyspnea, their pathophysiologic and clinical consequences
and the role of bronchodilators with a particular focus
on glycopyrronium at improving health status and health
related quality of life of COPD patients by decreasing
the hyperinflation.
Pathophysiology and consequences of lung
hyperinflation in COPD
The volume of air introduced into the lungs during quiet
breathing (tidal volume, VT) is sufficient for pulmonary
ventilation and gas exchange. The amount of air present
in the lungs at the end of a normal expiration is the
functional residual capacity (FRC) that includes expiratory reserve volume (ERV) and residual volume (RV, the
volume of air remaining in the lungs after a deep expiration), which is a result of the force displayed by expiratory muscles in the healthy young people to overcome
chest wall elasticity, while in the elderly it increases due
to a reduced elastic force of the lung [4]. At this level,
there is a static equilibrium between the lung and the
chest cage, because the outwards force of chest cage is
completely counterbalanced by the inwards force of pulmonary elastic recoil and this is defined as relaxation
volume, i.e. the pulmonary pressure equals zero, and
there is no flow through the airways. During exercise or
in other situations when requested, the volume of inspiration increases also utilizing the inspiratory reserve
(IRV) until the total lung capacity (TLC) is reached.
TLC and VC (vital capacity, that is the maximum volume of air that is possible to mobilize with a deep inspiration followed by a deep expiration) are important
reference indices in diseases causing a restrictive defect,
as pulmonary fibrosis, respiratory muscle disorders, and
chest wall alterations (Figure 1A).
In the volumetric partition of VC [5] particular value
is now attributed to inspiratory capacity (IC, sum of VT
and IRV) because, when reduced, it may testify a condition of lung hyperinflation (LH), caused by the increase
in RV, FRC, and TLC [6], as frequently observed in
COPD patients [7]. In these patients, IC showed a more
significant correlation with the exercise tolerance than
the forced expiratory volume in one second (FEV1) [8].
In addition, several studies demonstrated that IC, also
when standardized for TLC (IC/TLC), as marker of lung
hyperinflation both in resting conditions (static LH) and
during exercise (dynamic LH),is an independent predictive factor of mortality in COPD patients [9,10], and also
indicative of a longer hospital stay following thoracic
surgery [11]. Therefore, an ideal bronchodilator should
demonstrate to be able to decrease the hyperinflation of
Page 2 of 10
the patient, increase inspiratory capacity and, consequently, increase exercise tolerance. Based on many
functional and clinical observations, IC, besides FEV1, is
increasingly used as an index to assess the efficacy of
bronchodilator drugs in COPD patients.
Several previous studies [12,13] demonstrated undeniably that the damage caused by the inhalation of toxic
compounds, like cigarette smoke and environmental pollutants, primarily involves the “small airways”. This definition refers to bronchioles with an internal diameter
equal to or lower than two millimeters, that is the terminal and respiratory bronchioles, thus a very peripheral
site in the lung and very close to gas exchanging zone
of pulmonary alveoli [14]. Patency of small airways is
normally maintained, especially in expiration, by the integrity of bronchial walls that, while lacking in cartilagineous framework, collapse only when the lung empting
is almost complete, and by the alveolar-airways attachments acting as elastic bands to maintain the bronchial
calibre. In smokers, the structural and functional lung
alterations progress more or less rapidly from the initial
small airways disease to an overt COPD [15,16]. At the
beginning of the disease, small airways closure may occasionally occur during tidal expiration, while with the
progression of the disease this alteration is constant and
associated with a severe expiratory flow limitation (EFL)
[17,18]. EFL is caused by the increase in airways resistance
consequence of a reduction of bronchial-bronchiolar caliber due to structural remodeling and augmented vagal
tone, together with the destruction of elastic pulmonary
tissue. The flows normally utilized are thus maximal,that
is the maximum expiratory flow is within the tidal volume
[18], and any further increase in pleural pressure does not
increase the expiratory flow which is only dependent on
the elastic recoil of the lung [19]. Since the elastic recoil
pressure raises in parallel with the increase in lung volume,when EFL occurs patients must breath at a higher
pulmonary volume to exploit the only mechanism able to
increase their expiratory flow. In these conditions, residual
volume increases due to the closure of the airways at
higher pulmonary volume and consequently FRC increases because the volume at which the balance between
the elastic pressures of the lung and chest wall occurs is
increased, leading, starting from dynamic hyperinflation,
eventually to a static lung hyperinflation (sLH). This has
important implications in that the work of inspiratory
muscles increases to counteract the augmented elasticity
of lung tissue. In addition, the increased pulmonary volume determines a shortening of the inspiratory muscles
which consequently generate a lower pressure for a certain
stimulus. In the natural history of the anatomic and functional damage of COPD a progressive alteration of pulmonary volumes occurs characterized by a progressive
increase in FRC and parallel decrease in IC until the
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
A
Page 3 of 10
B
Figure 1 Lung volumes and capacities in normal subjects and in COPD patients. A) Lung volumes and capacities in healthy subject: EELV,
end-expiratory lung volume, ERV, expiratory reserve volume; FRC, functional residual capacity; IC, inspiratory capacity; IRV, inspiratory reserve volume;
RV, residual volume; TLC, total lung capacity; VC, vital capacity; VT, tidal volume. B) Progressive increasing in static lung hyperinflation in relation to
severity of COPD; arrow 1 indicates the threshold of dyspnea onset; arrow 2 indicates the limit of dyspnea tolerance. Modified from [19].
patient inevitably develops dyspnea even during quiet
breathing and it is impossible to increase the extent of
ventilation beyond a certain limit [20] (Figure 1B).
Thus, lung hyperinflation and the consequent alterations of respiratory mechanics determine an increased
respiratory work that in turn leads to fatigue of respiratory muscles that must sustain a greater load, with
inefficiency of respiration and onset of respiratory failure, initially characterized only by hypoxemia and then
also by hypercapnia. Dyspnea usually arises when gas
exchange is inefficient as in ventilation/perfusion mismatching, exercise-induced hypoxemia, and impaired
respiratory mechanics, where an uncoupling occurs between the increased ventilatory stimulus and the decreased mechanical performance. In the most severely
compromised COPD patients, dyspnea occurs also for
small efforts and consequently an activity limitation
develops that leads to deconditioning and worsening of
health-related quality of life (HRQoL) [20].
To accomplish a normal expiration and reach the relaxation volume, the patient affected by EFL needs longer
expiratory time as the expiratory flow is lower. Therefore,
the inspiration starts at an end-expiratory lung volume
(EELV) greater than the relaxation volume leading to dynamic lung hyperinflation (dLH) [21]. Thus, when EFL
arises in COPD patients [22], they breath with progressively increased lung volumes (increased FRC and equally
decreased IC). In this situation the activation of expiratory
muscles, while not increasing the expiratory flow, may aggravate the dyspnea perception by collapsing intrathoracic
airways beyond the bronchial closing point [23]. When
EELV increases, normal breathing takes place at a higher
absolute lung volume and VT is situated in a more flatted
upper part of the pressure – volume curve of the respiratory system, such as for its attainment inspiratory
muscles must sustain a greater elastic work. Furthermore, due to inadequate time for expiration, the relaxation volume is not reached and the mean alveolar
pressure at the end of expiration exceeds the atmospheric
pressure and has a positive value that is called intrinsic
positive end-expiratory pressure (PEEPi). This represents
a further elastic respiratory load for the inspiratory muscles.
In fact, when inspiration begins inspiratory muscles must
counterbalance this pressure load before generating a negative alveolar pressure that determines the inspiration and
the achievement of VT. Thus, in COPD patients with dLH,
while inspiratory muscles are able to generate a lower pressure for a given stimulus due to their anatomic and functional change caused by LH, they have to sustain a greater
workload in relation to the increased pulmonary volume at
which VT is fulfilled and to the threshold load charged by
PEEPi [17,18,24,25] (Figure 2). The level of PEEPi has been
found to be correlated with the resting hypercapnia [26].
When these dynamic conditions develop, a rapid increase
in FRC takes place caused by air trapping at the end of expiration and dynamic hyperinflation of the lungs, together
with a parallel decrease in IC, because patients increase the
breathing frequency and further shorten the expiratory
time. In fact, while in the normal subject at the onset of an
exercise there is a fall of EELV, such as the respiratory
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
Page 4 of 10
Figure 2 Pressure-volume curve of the respiratory system. EELV, end-expiratory lung volume: (1) in healthy subjects, (2) in subjects with lung
hyperinflation; PEEPi, intrinsic end-expiratory positive pressure; VT, tidal volume.
system remains on the steeper part of the pressure-volume
relationship, and VT increases also utilizing part of the inspiratory reserve (IRV), in a subject with EFL and LH tidal
volume cannot be increased beyond a certain level because
any further elevation of pressure cannot generate any
volume increase [18,27]. However, the breathing frequency
is augmented as a compensation attempt, resulting in further rise of EELV. In addition, the new positioning of VT
along the pressure-volume curve of the respiratory system
is such that VT lies closer to TLC, and the IRV is
decreased. This is a further limiting factor because the
“dyspnea limit”, that is the volume level at which dyspnea
becomes unbearable, has been shown to be when IRV is
lower than half a litre [28]. Bronchodilators, the cardinal
of COPD therapy, break this vicious circle by reducing
the airway obstruction, which leads to decreasing of the
residual volume allowing patients longer exercise time
which has many beneficial aspects for the patients daily
life and disease progress. A significant correlation also
appeared between the IC decrease and the dyspnea
presence and degree both during exercise testing and
during normal daily activities in COPD patients [29].
Effects of glycopyrronium on lung hyperinflation and its
consequences
Due to persistent airflow limitation in COPD, bronchodilators, especially the long-acting ones, are the cornerstone of the long-term treatment of this disease, with
the aim of decreasing to the minimum the airways resistances and improving the parameters closely correlated
with the patient’s health status and prognosis, like symptoms, acute exacerbations, exercise tolerance and physical and psychic general conditions.
The efficacy of long-acting bronchodilators in COPD
has been extensively documented in studies performed
both with beta2-agonists (LABAs) [30,31] and with muscarinic antagonists (LAMAs) [32,33], as the cholinergic
tone is recognized as the major reversible component of
the airflow obstruction in this disease [34]. In almost all
studies the primary outcome measure to assess the drug
efficacy was the FEV1, whose changes however are poorly
correlated with the variations of symptoms and exercise
tolerance, which instead are related to changes of lung
hyperinflation [35,36]. Therefore, in order to assess the efficacy of a bronchodilator in COPD, the physiologically
more reliable parameter is the inspiratory capacity, which
correlates inversely with FRC and can thus be considered
a marker of changes of LH.
In fact, it has been demonstrated that LH is, at least in
part, reversible with administration of bronchodilators,
and lung deflation causes an increase in IC and symptoms improvement in COPD patients. In these patients,
the increase in FEV1 after bronchodilation is generally
small, if any, while the most important effect is the increase in IC, which sustains the symptoms improvement,
even if the indices expressing the rate of bronchial caliber, like the FEV1/FVC ratio, may sometimes be
scarcely improved [37,38]. Noteworthy is the observation that FRC increases exponentially with the progressive reduction of FEV1 and the most significant change
after bronchodilation is the decrease in FRC and RV,
that is in LH, independently from the basal FEV1 value
[27]. During dynamic conditions it has been also observed that the prolongation of “endurance time” (ET),
i.e. the span of time in which the exercise is tolerated, is
more related to the effect of bronchodilators than other
parameters assessed during cycloergometer exercise or
6 minutes walking test (6MWT) [39]. This means that
bronchodilators decrease directly the hyperinflation and
increase the exercise capacity.
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
Beneficial effects on IC increase have been obtained
also with beta2-agonists characterized by a particularly
long duration (lasting 24 hours) of action (“ultra-LABA”)
that allows a single daily administration. In a trial [40]
comparing formoterol and indacaterol the latter at 300
mcg OD provided a greater effect on bronchial obstruction and LH than the former at usual dose of 12 mcg
BID in patients with COPD. A short-term trial by Rossi
et al. [41] eventually confirmed that indacaterol 150 mcg
OD is capable of increasing IC significantly more than
placebo. In the same study the effect was also numerically higher than tiotropium bromide (TB) without reaching significance. Interestingly, taking into account the
maximum increase of IC, more patients with indacaterol
exceeded 20% and 30% improvement compared to TB
indicating that indacaterol is capable of producing great
improvements in some patients.
On the other hand, also antimuscarinic bronchodilators have proven to be very useful in terms of lung deflation and exercise tolerance. Recently, new long-acting
LAMAs with several positive characteristics have been
introduced into clinical use among which glycopyrronium has shown to be particularly effective.
Glycopyrronium bromide (GB) has a quaternary ammonium structure and low oral bioavailability, that reduces the drug’s systemic effects [42]. Glycopyrronium is
delivered by a dry-powder inhaler (DPI), the Breezhaler®,
that has a low resistance and requests a lower inspiratory flow, thus easy to be utilized by COPD patients of
different age and severity, and already widely used to inhale indacaterol dry-powder [43,44].
The longer-lasting effect of GB compared to other
anticholinergic drugs allows a single daily administration,
which can facilitate the therapy of a disease that needs a
chronic bronchodilation by decreasing the mechanic stress
of the airways avoiding repeated bronchoconstriction, and
by increasing patient’s adherence to treatment plan and
thus obtaining better clinical results [45-47].
In a first phase III randomized study [48] of 26 weeks
with 822 patients with moderate-to-severe COPD, effectiveness, safety and tolerability of GB versus placebo were
assessed. The study demonstrated that glycopyrronium rapidly and significantly increased trough FEV1 compared to
placebo on the first day of therapy and remained elevated
for 26 weeks. Mean trough FEV1 at the 12th week, calculated as mean of values recorded between 23.15 and 23.45
hours, was significantly (p < 0.001) higher in patients given
GB than in those treated with placebo, and the difference
was 108 ± 14.8 mL, thus greater than the minimum clinically important difference (MCID) for FEV1 that is 100 mL
[49], reaching 113 ± 16.5 at 26th week. Inspiratory capacity,
an important indicator for hyperinflation, was also significantly improved by glycopyrronium reaching a difference
of 104 mL versus placebo already at day 1 and maintaining
Page 5 of 10
this difference over 26 weeks (p < 0.001 vs. placebo in all
cases) [48] (Figure 3), demonstrating that glycopyrronium
is an effective bronchodilator which provides sustainable
bronchodilation and decreases the hyperinflation. As a
consequence of bronchodilation and LH decrease, at the
26th week the dyspnea degree, measured as TDI (Transitional Dyspnea Index) score was significantly (p < 0.001)
improved in COPD patients treated with glycopyrronium
compared to those given placebo, exceeding even the limit
of clinically important difference and suggesting that patients perceived the improvement. In addition, the rate of
patients treated with GB presenting a clinically significant
improvement of HRQoL measured with the SGRQ (Saint
George’s Respiratory Questionnaire) was greater than that
of patients who took placebo. As already underlined, lung
hyperinflation causes dyspnea and reduces exercise tolerance in COPD patients and the increase in IC after GB administration is the evidence for the reduction of lung
hyperinflation. The results of this study [48] indicate that
glycopyrronium is capable of positively and significantly
affecting lung hyperinflation, symptoms, and psychophysical status of COPD patients, likely allowing them to
better use the tidal volume and improve the respiratory
performance, in presence of a rate of adverse events (AEs)
lower than with placebo.
The favorable results obtained in this study represented the basis for a second trial [50] whose objective
was to evaluate the efficacy and tolerability of GB, not
only versus placebo but also in relation to TB given
“open-label” for a period of 52 weeks in 1,066 patients
with moderate to severe COPD. GB induced a very fast
bronchodilation within 5 minutes after the first administration at the onset of therapy, greater than that caused
by tiotropium and placebo (p < 0.01). At the 26th week,
bronchodilation induced by GB, measured as area under
the curve (AUC) from the administration of the drug
until the 4th hour, was greater than that with TB and placebo (p < 0.01). Importantly, at the end of first day of
therapy, and at 26th and 52nd week, the difference between GB and placebo was 91,134, and 108 mL respectively (p < 0.001), approaching rapidly the MCID and
maintaining it over the time, whereas the significant (p <
0.001) difference between tiotropium and placebo was
under the MCID over time (83, 84, and 89 mL respectively). The increase in IC with GB was greater than with
placebo (p < 0.001) and similar to that with TB. Thus, the
results of this second study demonstrated that the administration of glycopyrronium was effective on all set endpoints and similar to that of TB, which at that moment was
the only once daily LAMA available for long-term treatment of COPD with inhalant antimuscarinic drugs. However, GB differed in a greater rapidity of action and higher
bronchodilating effects compared with TB on the first day
of administration, which was maintained at the 12th, 26th,
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
Page 6 of 10
Figure 3 Difference of inspiratory capacity (IC) values between glycopyrronium bromide and placebo at the end of the first day and at
12th and 26thweek of therapy before the administration of the active drug or placebo. Δ = Difference between glycopyrronium bromide
and placebo.
and 52nd week. The faster bronchodilation after the administration of the drug may give the patient the possibility to carry out the morning activities easier, a period of
the day which is considered the most worrisome by the
majority of patients [51]. The benefit from the fast
bronchodilating effect of GB, which maintains throughout
the time and produces a decrease in lung hyperinflation
and dyspnea, is not only particularly relevant for patients
daily activities, previously limited by LH and its consequences, but it also favours a greater adherence to treatment.The consequences of reduced hyperinflation have
been investigated in another multicentric, cross-over, and
randomized phase III study of 21 days [52], whose main objective was to assess the effect of GB 50 mcg OD on exercise tolerance in patients with moderate-to-severe COPD,
where the exercise tolerance and inspiratory capacity were
measured as ET during a constant submaximal exercise test
(SMET). Even on the first day, glycopyrronium allowed patients to tolerate exercise for a longer time than placebo
(the difference was 43.1 seconds more with GB p < 0.001)
and the time difference at the 21st day was further increased
(1 min and 29 sec more with GB, p < 0.001) (Figure 4). The
greater exercise capacity observed in this study with GB administration, even in terms of lower muscular exhaustion
during exertion, is really important also because, in relation to what emerged from other studies [53], patients
can certainly perceive the improvement and become more
active and less detached from the social framework, with
improved quality of life. The increase in exercise tolerance
is mainly caused by the effective and sustained
Figure 4 Endurance time (ET) on the first and 21st day of therapy with glycopyrronium bromide (GB) or placebo in patients with
moderate-to-severe COPD. From the data of [52].
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
bronchodilation afforded by GB (p < 0.05 vs. placebo)
which on turn determines a decrease in airways resistance
and lung hyperinflation, in this study witnessed by the significant increase in airways conductance and inspiratory
capacity, calculated “isotime” during the exertion in the
course both of GB and of placebo therapy. In fact, the inspiratory capacity during GB therapy increased more than
200 mL compared to placebo both at the beginning of the
study and after 3 weeks (Figure 5) (52). This functional
benefit turned into a symptoms improvement, with a
significant and clinically important [54] decrease in dyspnea measured with Borg CR10 and TDI scores during
treatment with glycopyrronium compared to placebo.
An increase in IC of 200 mL or more is a remarkable
benefit in patients with seriously limited respiratory
operational volumes, because the elastic charge, and
consequently the effort, is lower during the respiratory
movement (LH decreases and respiratory reserve is
better utilized) and dyspnea level decreases during normal
daily activities. In addition, the incidence of adverse events
(AEs) was similar to that of patients receiving placebo and
the majority of AEs were mild or moderately severe and
no death occurred during the study [52], thus confirming
the safety of glycopyrronium as already demonstrated in
previous studies where also serious AEs (SAEs) occurred
with a lower frequency in the GB group compared with
TB and placebo groups [50].
Quite recently, the results of this study have been confirmed by a new evaluation of efficacy and safety of glycopyrronium versus blinded tiotropium [55] in a 12-week
study with 657 patients with moderate-to-severe COPD.
The choice of blinding TB has been taken to minimize
possible sources of bias that could arise in open-label
studies. In fact, patients who know they are given an active
drug or have had previous experience of it may be more
Page 7 of 10
prone to report favorable results, or may be influenced on
their decision about remaining on treatment [56]. This
was the first trial where GB has been compared with
blinded TB. Briefly, following the first dose on the 1st
day of treatment GB produced greater FEV1 values than
TB with least squares mean (LSM) differences of 51 mL
and 63 mL compared to TB at 5 min and 15 min postdose respectively (both p < 0.001), and FEV1 was greater
with GB than with TB at all time points from 0 to 4
hours post-dose (p < 0.001). Glycopyrronium also determined a significantly higher increase in inspiratory capacity than tiotropium at 30 min (p < 0.001) and 2 hours
(p < 0.001) after the dose administration indicating to a
higher reduction of hyperinflation. At week 12 FEV1 and
other spirometric variables were comparable between GB
and TB, as well as TDI focal score, SGR total score, incidence of moderate or severe COPD exacerbations, whereas
the mean daily total symptom score was significantly (p =
0.035) lower with GB than with TB. The safety of glycopyrronium was confirmed also in this recent investigation, because the overall incidence of AEs, SAEs and AEs leading
to discontinuation was low and similar between the two
treatment groups. This study designed to minimize the possible bias once more demonstrates that in patients with
moderate-to-severe COPD glycopyronium has similar efficacy and safety to tiotropium, but provides a faster onset
of action compared with tiotropium on the first day of
therapy.
Conclusions
Based on the results of the above mentioned studies, glycopyrronium has proven to be capable of inducing favourable
effects on lung hyperinflation and its functional and clinical
consequences. Bronchodilation afforded by glycopyrronium
is more rapid than that of tiotropium since the first dose,
Figure 5 Values of inspiratory capacity (IC) “isotime” during exercise on the first and 21th day of therapy with glycopyrronium
bromide (GB) or placebo. Modified from [53].
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
and maintains this effect all over 24 hours with a single
daily dose. This certainly represents an advantage in terms
of adherence to therapy, because it is well known that the
efficacy of a therapy also depends on the patient’s adherence to treatment, that must be agreed by the patient once
the therapeutical plan has been justified and explained in
all details.
Among the crucial factors for adherence, particularly important are the easiness and reliabity of the device and the
dosing regimen [46], especially for COPD patients who
mostly are old and can present cognitive defects. In fact, incorrect use of inhalation devices is not rare in COPD and it
may be determined not only by patient-related factors, but
also by the inhaler characteristics and patient’s education
[57-59]. The dose of drug delivered from a DPI depends on
a correct handling of the device, the internal resistance of
the inhaler, and its ability to generate fine particles that can
spread till peripheral airways [60]. In this context the Breezhaler® appears a very reliable and user-friendly device: besides having a low intrinsic resistance facilitating high
inspiratory flow rates (in excess of 60 L/min) [44], the fine
particle fraction (FPF) generated by Breezhaler® is 26.8% of
the delivered dose versus 9.8% of HandiHaler® (the DPI to
deliver tiotropium) [57] such as the former provides greater
mean intrathoracic drug deposition (31% vs. 22%) and
lower extrathoracic drug deposition (57% vs. 71%) than the
latter. In an open-label, multicenter, two-period, 7-day
crossover study [57] including 82 patients with moderateto-severe COPD were assessed the patient’s corrected inhaler use and the patient’s inhaler preference for Breezhaler®
and Handihaler® relatively to the various steps in use. The
percentage of patients correctly using the inhaler increased
from 1st to 7th day and there was no significant difference
between the two devices. On the contrary, patients
expressed the preference for Breezhaler® in a significantly higher percentage compared to Handihaler®
(61% vs. 31% p < 0.01) because of its greater overall comfort, simplicity and confidence in use (confidence that inhalation of drug has been correctly performed).
Semplification of therapeutical regimen by reducing
the number of doses to take led to a greater adherence
to treatment in patients affected with chronic diseases
and mainly with COPD [61,62]. In addition, a lower adherence to treatment has been found to cause a marked
worsening of health status [63], whereas the adherence
to inhalant therapy in COPD is associated with a lower
risk of death and hospitalization for acute exacerbations
[46]. Even the rapidity of action of a drug and the perception of the effect it produces when correctly taken
according to physician’s instructions are important factors to strengthen the adherence to therapy. In fact, it
has been demonstrated that patients more adherent to
therapy are those who take it correctly, report a substantial improvement due to therapy, and think their doctor is
Page 8 of 10
an effective support [64]. Thus, in relation to these issues
glycopyrronium appears particularly reliable due to rapidity of its action, the easiness of inhaler, and the clinically
important long-lasting bronchodilation and symptoms
control it provides.
As to concerns the characteristic of particularly long
bronchodilation afforded by GB, Beeh [45] points out
that, differently from short-acting or twice daily bronchodilators, after GB administration there is a marked
increase in AUC 0-24 of FEV1 and an increased value of
trough FEV1 in the morning, that is the worst time of
day for COPD symptoms [51] particularly in patients
with severe disease [65], suggesting that the drug behaves like an endobronchial pharmacological stent that
guarantees a continuous patency of the airways. This
can positively affect lung hyperinflation and inspiratory
capacity because it is conceivable that the greater and
persistent bronchodilation, especially at the level of peripheral airways, determines a more complete pulmonary
empting during tidal breathing and improves the respiratory mechanics, with consequent decrease in dyspnea
and increase in exercise capacity. Such effect has been
assimilated to that induced by surgical reduction of lung
volume that is successfully performed in patients with
upper lobes emphysema (pharmacological lung volume
reduction).
Competing interests
The author declares that he has no competing interests.
Acknowledgements
Financial support for medical editorial assistance was provided by Novartis
Pharmaceuticals Italy. We thank Dr. Evren Karayel and Dr. Francesco Sergio
from Novartis Pharmaceuticals Italy for their medical editorial assistance with
this manuscript.
Received: 12 March 2014 Accepted: 25 March 2014
Published: 1 April 2014
References
1. Age.Na.S: Broncopneumopatia cronica ostruttiva. Linee guida nazionali di
riferimento per la prevenzione e la terapia. Roma; 2010.
2. AIMAR, AIPO, SIMeR, SIMG: La gestione clinica integrata della BPCO; 2013.
http://www.aimarnet.it.
3. GOLD: Global Strategy for the Diagnosis, Management and Prevention of
COPD. Global Initiative for Chronic Obstructive Lung Disease (GOLD); 2014.
http://www.goldcopd.org/.
4. Leith DE, Mead J: Mechanisms determining residual volume of the lungs
in normal subjects. J Appl Physiol 1967, 23:221–227.
5. Flesch JD, Dine CJ: Lung volumes. Measurement, clinical use, and coding.
Chest 2012, 142:506–510.
6. Bancalari E, Clausen J: Pathophysiology of changes in absolute lung
volumes. Eur Respir J 1998, 12:248–258.
7. Tantucci C, Duguet A, Similowki T, Zelter M, Derenne J-P, MilicEmili J: Effect
of salbutamol on dynamic hyperinflation in chronic obstructive pulmonary
disease patients. Eur Respir J 1998, 12:799–804.
8. Diaz O, Villafranca C, Ghezzo H, Borzone G, Leiva A, Milic-Emil J, Lisboa C: Role
of inspiratory capacity on exercise tolerance in COPD patients with and
without expiratory flow limitation at rest. Eur Respir J 2000, 16:269–275.
9. Casanova C, Cote C, de Torres JP, Aguirre-Jaime A, Marin JM, Pinto-Plata V,
Celli BR: Inspiratory-to-total lung capacity ratio predicts mortality in
patients with chronic obstructive pulmonary disease. Am J Respir Crit Care
Med 2005, 171:591–597.
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
10. Tantucci C, Donati P, Nicosia F, Bertella E, Redolfi S, De Vecchi M, Corda L,
Grassi V, Zulli R: Inspiratory capacity predicts mortality in patients with
chronic obstructive pulmonary disease. Respir Med 2008, 102:613–619.
11. Matsuo M, Hashimoto N, Usami N, Imaizumi K, Wakai K, Kawabe T, Yokoi K,
Hasegawa Y: Inspiratory capacity as a preoperative assessment of
patients undergoing thoracic surgery. Interact Cardiovasc Thorac Surg
2012, 14:560–564.
12. Hogg JC, Macklem PT, Thurlbeck WM: Site and nature of airway
obstruction in chronic obstructive lung disease. N Engl J Med 1968,
278:1355–1360.
13. Hogg JC, Chu F, Utokaparch S, Woods R, Elliott WM, Buzatu L, Cherniack RM,
Rogers RM, Sciurba FC, Coxon HO, Parè PD: The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004,
350:2645–2653.
14. Weibel ER: Morphometry of the human lung. New York: Academic Press; 1963.
15. Milic-Emili J: Provocative hypothesis: does mechanical injury of the
peripheral airways play a role in the genesis of COPD in smokers?
J Chron Obstruct Pulm Dis 2004, 1:85–92.
16. Gennimata S-A, Palamidas A, Karakontaki F, Kosmas EN, Koutsoukou A, Loukides
S, Koulouris NG: Pathophysiology of evolution of small airways disease to overt
COPD. J Chron Obstruct Pulm Dis 2010, 7:269–275.
17. Tantucci C: Limitazione dei flussi. In Il volto della BPCO che cambia,
Fisiologia Clinica, Volume 2. Edited by Giuntini C, Grassi V. Torino: Utet
Periodici; 2001:21–27.
18. Calverley PMF, Koulouris NG: Flow limitation and dynamic hyperinflation: key
concepts in modern respiratory physiology. Eur Respir J 2005, 25:186–199.
19. Mead J, Turner JM, Macklem PT, Little JB: Significance of the relationship
between lung elastic recoil and maximum expiratory flow. J Appl Physiol
1967, 22:95–106.
20. Cooper CB: The connection between Chronic Obstructive Pulmonary
Disease symptoms and hyperinflation and its impact on exercise and
function. Am J Med 2006, 119(10A):S21–S31.
21. Macklem PT: Hyperinflation. Am Rev Respir Dis 1984, 129:1–2.
22. Koulouris NG, Dimopoulou I, Valta P, Finkelstein R, Cosio MG, Milic-Emili J:
Detection of expiratory flow limitation during exercise in COPD patients.
J Appl Physiol 1997, 82:723–731.
23. O’Donnell DE, Sanii R, Anthonisen NR, Younes M: Effect of dynamic airway
compression on breathing pattern and respiratory sensation in severe
chronic obstructive pulmonary disease. Am Rev Respir Dis 1987, 135:912–918.
24. O’Donnell DE, Bertley JC, Chau LKL, Webb KA: Qualitative aspects of
exertional breathlessness in chronic airflow limitation. Pathophysiologic
mechanisms. Am J Respir Crit Care Med 1997, 155:109–115.
25. Yan S: Sensation of inspiratory difficulty during inspiration threshold and
hyperinflation loadings. Effect of inspiratory muscle strength. Am J Respir
Crit Care Med 1999, 160:1544–1549.
26. Haluszka J, Chartrand DA, Grassino AE, Milic-Emili J: Intrinsic PEEP and arterial
PCO2 in stable patients with chronic obstructive pulmonary disease. Am
Rev Respir Dis 1990, 141:1194–1197.
27. Johnson BD, Reddan WG, Pegelow DF, Seow KC, Dempsey JA: Flow
limitation and regulation of functional residual capacity during exercise
in a physically active aging population. Am Rev Respir Dis 1991, 143:960–
967.
28. O’Donnel DE, Voduc N, Fitzpatrick M, Webb KA: Effect of salmeterol on the
ventilatory response to exercise in chronic obstructive pulmonary
disease. Eur Respir J 2004, 24:86–94.
29. Marin JM, Carrizo SJ, Gascon M, Sanchez A, Gasllego B, Celli BR: Inspiratory
capacity, dynamic hyperinflation, breathlessness, and exercise
performance during the 6-minute-walk test in chronic obstructive
pulmonary disease. Am J Respir Crit Care Med 2001, 163:1395–1399.
30. Mahler DA, Donohue JF, Barbee RA, Goldman MD, Gross NJ, Wisniewski ME,
Yancey SW, Zakes BA, Rickard KA, Anderson WH: Efficacy of salmeterol
xinafoate in the treatment of COPD. Chest 1999, 115:957–965.
31. Dahl R, Greefhorst LA, Nowak D, Nonikov V, Byrne AM, Thomson MH, Till D,
Della Cioppa G, on behalf of Formoterol in Chronic Obstructive Pulmonary
Disease I Study Group: Inhaled formoterol dry powder versus ipratropium
bromide in chronic obstructive pulmonary disease. Am J Respir Crit Care
Med 2001, 164:778–784.
32. Casaburi R, Mahler DA, Jones PW, Wanner A, San PG, ZuWallack RL,
Menjoge SS, Serby CW, Witek T Jr: A long-term evaluation of once-daily inhaled tiotropium in chronic obstructive pulmonary disease. Eur Respir J
2002, 19:217–224.
Page 9 of 10
33. Tashkin DP, Celli B, Senn S, Burkhart D, Kesten S, Menjoge S, Decramer M:
A 4-year trial of tiotropium in chronic obstructive pulmonary disease.
N Engl J Med 2008, 359:1543–1554.
34. Belmonte KE: Cholinergic pathways in the lungs and anticholinergic
therapy for chronic obstructive pulmonary disease. Proc Am Thorac Soc
2005, 2:297–304.
35. Celli B, ZuWallack R, Wang S, Kesten S: Improvement in resting inspiratory
capacity and hyperinflation with tiotropium in COPD patients with
increased static lung volumes. Chest 2003, 124:1743–1748.
36. O’Donnell DE, Flüge T, Gerken F, Hamilton A, Webb K, Aguilaniu B, Make B,
Magnussen H: Effects of tiotropium on lung hyperinflation, dyspnoea and
exercise tolerance in COPD. Eur Respir J 2004, 23:832–840.
37. Deesomchock A, Webb KA, Forkert L, Lam Y-M, Ofir D, Jensen D, O’Donnell DE:
Lung hyperinflation and its reversibility in patients with airway obstruction
of varying severity. J Chron Obstruct Pulm Dis 2010, 7:428–437.
38. O’Donnell DE, Forkert L, Webb KA: Evaluation of bronchodilator responses
in patients with “irreversible” emphysema. Eur Respir J 2001, 18:914–920.
39. Oga T, Nishimura K, Tsukino M, Hajiro T, Ikeda A, Izumi T: The effects of
oxitropium bromide on exercise performance in patients with stable
chronic obstructive pulmonary disease: a comparison of three different
exercise tests. Am J Respir Crit Care Med 2000, 161:1897–1901.
40. Beier J, Beeh KM, Brookman L, Peachey G, Hmissi A, Pascoe S:
Bronchodilator effects of indacaterol and formoterol in patients with
COPD. Pulm Pharmacol Ther 2009, 22:492–496.
41. Rossi A, Centanni S, Cerveri I, Gulotta C, Foresi A, Cazzola M, Brusasco V:
Acute effects of indacaterol on lung hyperinflation in moderate COPD: a
comparison with tiotropium. Respir Med 2012, 106:84–90.
42. Ali-Melkkila T, Kanto J, Iisalo E: Pharmacokinetics and related
pharmacodynamics of anticholinergic drugs. Acta Anaesthesiol Scand
1993, 37(7):633–642.
43. Buhl R, Banerji D: Profile of glycopyrronium for once-daily treatment of
moderate-to-severe COPD. J Chron Obstruct Pulm Dis 2012, 7:729–741.
44. Pavkov R, Mueller S, Fiebich K, Singh D, Stowasser F, Pignatelli G, Walter B,
Ziegler D, Dalvi M, Dederichs J, Rietveld I: Characteristics of a capsule
based dry powder inhaler for the delivery of indacaterol. Curr Med Res
Opin 2010, 26:2527–2533.
45. Beeh KM, Bejer J: The short, the long, and the “ultra-long”: why duration
of bronchodilator action matters in chronic obstructive pulmonary
disease. Adv Ther 2010, 27:150–159.
46. Bourbeau J, Bartlett SJ: Patient adherence in COPD. Thorax 2008, 63:831–838.
47. Vestbo J, Anderson JA, Calverley PMA, Anderson JA, Celli B, Ferguson GT, Jenkins
C, Knobil K, Willits LR, Jates JC, Jones PW: Adherence to inhaled therapy,
mortality and hospital admission in COPD. Thorax 2009, 64:939–943.
48. D’Urzo A, Ferguson GT, van Noord JA, Hirata K, Martin C, Horton R, Lu Y,
Banerji D, Overend T: Efficacy and safety of once-daily NVA237 in patients
with moderate-to-severeCOPD: the GLOW1 trial. Respir Res 2011, 12:156.
49. Cazzola M, MacNee W, Martinez FJ, Rabe KF, Franciosi LG, Barnes PJ,
Brusasco V, Burge PS, Calverley PMA, Celli BR, Jones PW, Mahler DA, Make B,
Miravitlles M, Page CP, Palange P, Parr D, Pistolesi M, Rennard SI, Rutten-van
Molken MP, Stockley R, Sullivan SD, Wedzicha JA, Wouters EF, on behalf of
the American Thoracic Society/European Respiratory Society Task Force on
outcomes of COPD: Outcomes for COPD pharmacological trials: from
lung function to biomarkers. Eur Respir J 2008, 31:416–469.
50. Kerwin E, Hébert J, Gallagher N, Martin C, Overend T, Alagappan VKT, Lu Y,
Banerji D: Efficacy and safety of NVA237 versusplacebo and tiotropium in
patients with COPD: the GLOW2 study. Eur Respir J 2012, 40:1106–1114.
51. Partridge MR, Karlsson N, Small IR: Patient insight into the impact of
chronic obstructive pulmonary disease in the morning: an internet
survey. Curr Med Res Opin 2009, 25:2043–2048.
52. Beeh KM, Singh D, Di Scala L, Drolimann A: Once-daily NVA237 improves
exercise tolerance from the first dose in patients with COPD: the GLOW3
trial. Int J Chron Obstruct Pulmon Dis 2012, 7:503–513.
53. Puente-Maestu L, Villar F, de Miguel J, Stringer WW, Sanz P, Sanz ML, García
de Pedro J, Martínez-Abad Y: Clinical relevance of constant power
exercise duration changes in COPD. Eur Respir J 2009, 34:340–345.
54. Witek TJ Jr, Mahler DA: Minimal important difference of the transition
dyspnoea index in a multinational clinical trial. Eur Respir J 2003,
21:267–272.
55. Chapman KR, Beeh K-M, Bejer J, Bateman ED, D’Urzo A, Nutbrown R, Henley
M, Chen H, Overend T, D’Andrea P: A blinded evaluation of the efficacy
and safety of glycopyrronium, a once-daily long-acting muscarinic
Sanguinetti Multidisciplinary Respiratory Medicine 2014, 9:19
http://www.mrmjournal.com/content/9/1/19
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
Page 10 of 10
antagonist, versus tiotropium, in patients with COPD: the GLOW5 study.
BMC Pulm Med 2014, 14:4.
Beeh K-M, Beier J, Donohue JF: Clinical trial design in chronic obstructive
pulmonary disease: current perspectives and considerations with regard
to blinding of tiotropium. Respir Res 2012, 13:52.
Chapman KR, Fogarty CM, Peckitt C, Lassen C, Jadayel D, Dederichs J,
Dalvi M, Kramer B, on behalf of the INDEED study investigators: Delivery
characteristics and patient’s handling of two single-dose dry-powder
inhalers used in COPD. Int J Chron Obstruct Pulmon Dis 2011, 6:353–363.
Hesselink AE, Penninx BW, Wijnhoven HA, Kriegsman DM, van Eijk JT:
Determinants of an incorrect inhalation technique in patients with
asthma or COPD. Scand J Prim Health Care 2001, 19(4):255–260.
Vincken W, Dekhuijzen PR, Barnes P, ADMIT Group: The ADMIT series – issues
in inhalation therapy. 4) How to choose inhaler devices for the treatment
of COPD. Prim Care Respir J 2010, 19(1):10–20.
Dolovich M: New propellant-free technologies under investigation.
J Aerosol Med 1999, 12(Suppl 1):S9–S17.
Claxton AJ, Cramer J, Pierce C: A systematic review of the associations
between dose regimens and medication compliance. Clin Ther 2001,
23:1296–1310.
Breekveldt-Postma NS, Koerselman J, Erkens JA, Lammers J-W J, Herinqs RMC:
Enhanced persistence with tiotropium compared with other respiratory
drugs in COPD. Respir Med 2007, 101:1398–1405.
Corden ZM, Bosley CM, Rees PJ, McLellan Cochrane G: Home nebulized
therapy for patients with COPD: patient compliance with treatment and
its relation to quality of life. Chest 1997, 112:1278–1282.
Turner J, Wright E, Mendella L, Anthonisen N: Predictors of patient
adherence to long-term home nebulizer therapy for COPD. The IPPB
Study Group. Intermittent Positive Pressure Breathing. Chest 1995,
108:394–400.
Kessler R, Partridge MR, Miravitlles M, Cazzola M, Vogelmeier C, Leynaud D,
Ostinelli J: Symptom variability in patients with severe COPD: a
pan-European cross-sectional study. Eur Respir J 2011, 37:264–272.
doi:10.1186/2049-6958-9-19
Cite this article as: Sanguinetti: The lungs need to be deflated: effects of
glycopyrronium on lung hyperinflation in COPD patients.
Multidisciplinary Respiratory Medicine 2014 9:19.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
REVIEW
Open Access
Expiratory CT scan in patients with normal
inspiratory CT scan: a finding of obliterative
bronchiolitis and other causes of bronchiolar
obstruction
Michele Gaeta1, Fabio Minutoli1*, Giuseppe Girbino2, Alessandra Murabito3, Caterina Benedetto1,
Rosario Contiguglia4, Paolo Ruggeri2 and Salvatore Privitera5
Abstract
Expiratory CT scan is usually obtained as supplement to normal inspiratory CT scan to recognize air-trapping, which
is expression of small airways obstruction. In some patients the air-trapping may be the only sign of an early-stage
small airways disease in an otherwise normal lung.
The purpose of this article is to illustrate pathologic conditions, namely obliterative bronchiolitis, in which expiratory
CT scan can be abnormal despite normal inspiratory CT examination, and to highlight indications for this technique
in patients with clinical and functional suspect of bronchiolar obstruction.
Keywords: Air trapping, CT, Expiratory CT scan, Inspiratory CT scan, Airways disease
Introduction
Expiratory CT scan is sensitive for the detection of airtrapping, which is a definitive sign of airway obstruction in various airway disease, including emphysema,
bronchiolitis obliterans, bronchial asthma, Swyer-James
syndrome, cystic fibrosis, sarcoidosis, hypersensitivity
pneumonitis [1,2]. In many of such patients abnormal
findings (i.e. areas of emphysema, bronchiectasis, groundglass opacity, tree-in-bud) are usually depicted by inspiratory
scan that permits a correct diagnosis. However, frequently,
the air-trapping may be the only finding of a pulmonary
disease in patients with a normal-appearing inspiratory CT
scan [3]. According to Fleischner Society glossary [4], “airtrapping is seen on end-expiration CT scans as parenchymal
lung areas with less than normal increase in attenuation
and lack of volume reduction”.
Although some authors recommend routine use of paired
inspiratory and expiratory CT scans in patients suspected
of having diffuse lung disease, this approach is questionable,
especially considering the delivered radiation. This is of
* Correspondence: [email protected]
1
Department of Biomedical Sciences and of Morphological and Functional
Images, University of Messina, Messina, Italy
Full list of author information is available at the end of the article
special concern in young patients or in subjects undergoing
repeated exposures [5].
The purpose of this article, which is based on more
than 100 consecutive patients who underwent expiratory
CT scan after a normal inspiratory CT examination, is to
illustrate diseases which may demonstrate abnormalities
on expiratory CT scan despite normal inspiratory CT scan,
as obliterative bronchiolitis and less usual causes of bronchiolar obstruction. Furthermore, we have highlighted the
indications for expiratory CT scan in patients with clinical
and functional suspect of bronchiolar obstruction.
Review
CT scan techniques
Inspiratory and expiratory CT scans are typically obtained
at the end of full inspiration and at the end of forced
expiration. Expiratory CT scan can be performed with a
volumetric or an incremental technique (a limited number
of slices at different levels with a section thickness of 1-mm
and a table increment of 10-mm). Moreover, it is possible
to modulate the radiation dose burden using a low-dose
acquisition by reducing the tube current. One study
© 2013 Gaeta et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
demonstrated that it is possible to reduce the tube currenttime product up to 20 mAs without impairing the
visualization of air-trapping [5].
Before expiratory scan, patients are usually instructed:
“Take a deep breath, blow out hard, and do not breathe
in again for 10 seconds.” It is useful that each patient
practices this breathing instructions several times before
scanning begin.
Both inspiratory and expiratory scans are performed
with the patient in the supine position from the apex to
the base of the lungs. No contrast medium administration
is necessary.
Inspiratory and expiratory CT images are reconstructed
by using a high-spatial-resolution (bone) algorithm at a
display window width of 1,600 Hounsfield Units (HU)
and a window center of −600 HU.
In recent years, several quantitative analyses for air
trapping evaluation are used [6-10]. The most widely
explored quantitative CT methods are density-based
measures: a) expiratory to inspiratory ratio of mean lung
density; b) expiratory to inspiratory relative volume change
of voxels with attenuation values between −860 and −950
HU and c) percentage of voxels below −856 HU in expiratory CT scan [6,7]. In a recent paper, the first of the above
mentioned measures performed significantly better than
the others in early detection of small airways disease on
low-dose CT [8].
Figure 1 34-year-old healthy subject. Inspiratory axial CT scan shows
the normal round shape of the trachea (a). Expiratory axial CT scan
shows the normal bowing forward of the posterior wall (b). Note the
normal homogeneous attenuation increase of the lung parenchyma.
Page 2 of 8
Figure 2 36-year-old healthy subject. Expiratory axial CT scan
demonstrates lobular air-trapping in an healthy subject.
Moreover, it has been demonstrated that lung volume
collapsibility, represented by the ratio of expiratory
to inspiratory lung CT computed volume, correlates
significantly with pulmonary function tests, tissue densitybased measures and disease severity in chronic obstructive
pulmonary disease [9,10].
Normal findings on expiratory CT scan
During expiration, a significant anterior bulging of the posterior fibromuscular membrane of the intrathoracic trachea
is seen. In particular, since the mean antero-posterior diameter of the trachea decreases by 32%, the trachea changes its
appearance from “round-shape” during inspiration to “letter
D-shape” during expiration. The bowing forward of the posterior tracheal wall (Figure 1) is the best criterion to understand whether a satisfactory expiration was achieved [11].
Finally, normal lung tissue increases homogeneously in
CT attenuation from inspiration to expiration (Figure 1)
Figure 3 Maximal expiratory and inspiratory maneuvers
plotted as a flow-volume curve. The thick vertical line indicates
the point of maximal flow after expelling 75% of the vital capacity.
The black area pointed by thick arrow indicates the typical variation
of expiratory curve in small airways obstruction. TLC = Total lung
capacity. RV = Residual volume.
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
Page 3 of 8
Figure 4 30-year-old man with chronic asthma. Coronallyreformatted inspiratory CT image shows normal lung parenchyma
(a). Coronally-reformatted expiratory CT image shows extensive
air-trapping (b). No collapse of trachea, main and lobar bronchi
could be seen on axial scan (not shown). Axial inspiratory CT image
through the lung bases shows normal bronchi (c). Axial expiratory
CT scan demonstrates extreme narrowing of the bronchial lumen
with air-trapping due to bronchial hyper-responsiveness (d).
because the volume of air in the lung being scanned
is reduced.
Air-trapping in healthy subjects
Air trapping, usually limited to fewer than three adjacent
secondary pulmonary lobules (“lobular air-trapping”)
(Figure 2), is frequently detected in asymptomatic healthy
subjects with normal pulmonary function. The high prevalence of air trapping in patients with normal pulmonary
function calls into question two possible explanations:
extensive difference in local lung compliance or muscle
tone of small airways without small-airway disorder;
presence of a small-airway disorder that is too mild to
be detected by percent predicted maximal expiration
flow (MEF50%) testing, because such testing does not have
adequate sensitivity for the detection of small-airway
disorder. Thus, several authors claim that expiratory CT
may be more sensitive in detecting local air trapping
than pulmonary function testing [12].
Pulmonary function tests
Small airways comprise airways of < 2mm in internal
diameter [13]. Traditionally, small airways are considered
a “silent zone” of the lungs [14] because they cover a vast
cross-surface area and airway volume vs large airways and
they can be extensively involved with little abnormalities
of conventional lung function tests [14]. However, small
airways are the major site of airflow limitation in COPD &
asthma [15,16] and can be interested in several lung
diseases [17]. The inspection of maximum expiratory
flow-volume curve (MEFV) is important to suspect a
functional small airways disease. Premature airways
closure, regional heterogeneity, progressive increases
of resistance with deflation contribute to characteristic
concavity shape of MEFV noted in the lower half of
vital capacity (VC) (Figure 3) [18]. Various indices can
be derived from the MEFV: flow after 25, 50 or 75% of
the FVC has been expired (FEV 25, FEV50 and FEV75)
or maximal mid-expiratory flow (MMEF) over 25-75% of
expired FVC [19]. They have a limited usefulness because
depend on FVC, have an high measurement variability and
correlate poorly with distal airways abnormalities [20,21]. A
small airways disease can be better functionally suspected
examining a complete lung function test with determination of lung volumes. A functional pattern characterized
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
Figure 5 55-year-old woman with known rheumatoid arthritis
complaining of exertional dyspnea, chronic cough and
obstructive pattern at respiratory tests. On coronally-reformatted
inspiratory CT image no lung abnormalities can be seen
(a). Coronally-reformatted expiratory CT image shows extensive
air-trapping (b). Note presence of subchondral cysts (arrows) and
narrowing of gleno-humeral joint spaces.
by a decreased VC and FEV1 and increased RV, but with a
normal FEV1/VC ratio and total lung capacity, reflects an
obstructive impairment of small airways [22]. Moreover a
reduction in FVC/SVC (slow vital capacity) is a validated
small airway marker of lung transplant – obliterative bronchiolitis [23]. Therefore an expiratory CT scan should not
be obtained before a careful interpretation of pulmonary
function test with determination of lung volumes.
Interval asthma and chronic bronchitis
Histologically, bronchial asthma and chronic bronchitis
are characterized by the presence of chronic inflammation
Page 4 of 8
Figure 6 23-year-old male with mushroom worker’s lung
disease referred for slight exertional dyspnea and dry cough
after two acute respiratory attacks. On coronally-reformatted
inspiratory CT image no lung abnormalities can be seen
(a). Coronally-reformatted expiratory CT image shows extensive
air-trapping (b). Diagnosis was confirmed by bronchoalveolar lavage.
of the airways that involves mainly the medium sized and
small bronchi. The bronchi are thickened by the combination of edema and an increase in the amount of smooth
muscle and in the size of the mucous glands. These histological changes are manifested on CT by the presence of
bronchial wall thickening and narrowing of the bronchial
lumen. However, in early stages of disease the obstruction
of the pulmonary airways is reversible and no abnormalities
are seen on inspiratory CT [24]. The air-trapping may
be the only indicator of pathology in an otherwise normal
lung. In chronic asthmatic patients marked expiratory
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
narrowing of the peripheral bronchi is due to bronchial
hyper-responsiveness (Figure 4).
Obliterative bronchiolitis
Obliterative bronchiolitis is defined histologically as
concentric luminal narrowing of the membranous and
respiratory bronchioles secondary to submucosal and
peribronchiolar inflammation and fibrosis without any
intraluminal granulation tissue or polyps. Obliterative
bronchiolitis can be cryptogenic, postinfectious (mostly,
secondary to prior viral or Mycoplasma infection), or
secondary to noxious fume inhalation, graft-versus-host
disease, lung transplantation, rheumatoid arthritis, inflammatory bowel disease, and penicillamine therapy [25,26].
In patients with obliterative bronchiolitis, since the
amount of abnormal soft tissue in and around the bronchioles is relatively small, direct CT signs of bronchiolitis (i.e. tree-in-bud) are usually absent on inspiratory
scan. The diagnosis of obliterative bronchiolitis is primarily based on patient history, pulmonary function test
results, and lung biopsy. Sometimes, expiratory CT scan
can depict air trapping before functional tests indicate
disease (Figure 5) [12].
Hypersensitivity pneumonitis
Hypersensitivity pneumonitis is a diffuse granulomatous
interstitial lung disease caused by inhalation of various
antigenic organic particles. Hypersensitivity pneumonitis is
often insidious to diagnose because the clinical manifestations are nonspecific and the radiological and histological
Page 5 of 8
patterns can mimic those of other interstitial and small
airway diseases. Early diagnosis is mandatory since patients
may develop UIP/NSIP lung fibrosis patterns [27].
The early stage of disease is characterized by cellular
bronchiolitis with presence of peribronchial inflammatory
infiltrates consisting of lymphocytes and plasma cells
causing bronchiolar obstruction. This stage of disease is
completely reversible and curtailing exposure to the causal
agent is the only effective long-term therapy [28]. The
small amount of cellular infiltration, which characterizes
this stage of disease, cannot be detected on inspiratory CT
scan performed between attacks. Expiratory CT scan is an
effective tool to identify air-trapping in patients clinically
suspected of having hypersensitiy pneumonitis (Figure 6).
Sarcoidosis
Sarcoidosis is a multisystem disorder that is characterized
by non-caseous epithelioid cell granulomas, which may
affect almost any organ. Pulmonary sarcoidosis is a disease
of the interstitium and occurs in approximately 90% of
patients. Usually advanced pulmonary sarcoidosis causes a
restrictive functional deficit due to fibrosis. On the other
hand, the granulomas developing in centrilobular and
peribronchiolar lymphatics frequently involve small airways;
thus, evidence of air-trapping is considered a common
feature of the disease [29].
In patients with early pulmonary sarcoidosis, small
granulomas cannot be detected since their size is beyond
the CT spatial resolution. In this stage, air trapping can
be the only finding of pulmonary involvement, heralding
Figure 7 38-year-old woman with cutaneous and pulmonary sarcoidosis complaining of a slight exertional dyspnea. Photograph of volar
forearms shows red-to-purple indurated plaques. Biopsy demonstrated cutaneous sarcoidosis (Lupus Pernio) (a). Coronally-reformatted inspiratory CT image
with soft tissue window settings, obtained two weeks after cutaneous biopsy, demonstrates mediastinal lymphoadenopathies (N) (b). Coronally-reformatted
inspiratory CT image with lung settings through the same level of (b) shows absence of lung abnormalities (c). Extensive air-trapping can be seen on
coronally-reformatted expiratory CT image (d). Coronally-reformatted inspiratory CT image, obtained six months after, shows typical sarcoidosis lung pattern
(multiple micronodules with a perilymphatic distribution both in lower and upper lobes) (e).
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
Page 6 of 8
the future appearance of micronodules with the typical
perilymphatic distribution (Figure 7).
Tracheobronchomalacia
Tracheobronchomalacia is a condition characterized by
excessive central airway collapsibility due to weakness of
the airway walls and supporting cartilage. The cause of
air trapping in tracheobronchomalacia patients is uncertain,
but it may reflect chronic small airways disease due to
abnormal respiratory mechanics related to excessive
central airway collapse. Because tracheobronchomalacia
is associated with an abnormal coughing mechanism and
difficulty in clearing secretions, affected patients experience
chronic inflammation of the small airways on this basis
[30]. The diagnosis of tracheobronchomalacia is made on
expiratory scan which demonstrates collapse of trachea
and/or large bronchi (reduction of anteroposterior diameter
more than 50%) and air-trapping (Figure 8).
Conclusion
Every pneumologist and radiologist should be aware that
the air-trapping may be the only finding of a pulmonary
disease in patients with a normal-appearing inspiratory CT
scan. The knowledge of the possible underlying disorders is
the key which permits to suspect the potential diagnoses.
Final diagnosis can be reached by means of one or more of
these approaches: transbronchial biopsy, open lung biopsy,
bronchoscopy, bronchioloalveolar lavage, laboratory tests,
response to therapy on follow-up.
We recommend that, after a normal inspiratory lung
CT scan, expiratory CT scan should be obtained, to avoid
useless irradation, only in patients who have one or more
of the following clinical scenarios:
1. patients with respiratory tests showing obstructive
pattern, particularly patients showing a small
airways obstruction pattern;
2. patients with chronic cough and/or wheezing;
3. patients with exertional dyspnea;
4. patients with demonstrated or suspected conditions
associated with small airways diseases, namely
sarcoidosis, hypersensitivity pneumonitis and
diseases that may cause bronchiolitis obliterans.
Finally, it is worth of attention that MR imaging of the
lung, whose main advantage is absence of radiation, is an
emerging tool in diagnosis of pulmonary diseases; namely,
in evaluating disease activity in chronic lung diseases [31],
in evaluating mucus-containing lung lesions [32] and
in diagnosing invasive mucinous adenocarcinoma (formerly
known as mucinous bronchioloalveolar carcinoma) [33-35].
In patients with small airway obstruction, MR imaging with
hyperpolarized Helium is an interesting diagnostic option
which allows a functional and dynamic evaluation of
Figure 8 64-year-old man with tracheobronchomalacia
complaining of chronic cough, exertional dyspnea and
wheezing. Inspiratory axial CT scan through upper lobes shows
normal trachea and lung (a). Expiratory axial CT scan demonstrates
collapse of trachea due to tracheobronchomalacia as well as
extensive air-trapping (b). On axial expiratory CT scan at subcarinal
level collapse of the intermediate (arrowhead) and lower lobar
(arrow) bronchi due to bronchomalacia can be seen (c). Note
extensive air-trapping of the lower lobes.
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
Page 7 of 8
pulmonary ventilation [36,37]; however, today it is not
widely disposable for clinical use since it is expensive and
difficult to perform. In the future a combined use of CT
and MR imaging could enhance our capacity to detect
more specific patterns of obstructive pulmonary diseases.
9.
Consent
Written informed consent was obtained from the
patients for publication of this report and any accompanying images.
11.
10.
12.
13.
Competing interests
The authors declare that they have no competing interests.
14.
15.
Authors' contributions
MG designed the study and participated in the manuscript drafting; FM
participated in imaging data acquisition, analysis and interpretation and in
revision of the manuscript; GG participated in clinical data acquisition,
analysis and interpretation; AM participated in imaging data acquisition,
analysis and interpretation; CB participated in imaging data acquisition,
analysis and interpretation; RC participated in clinical data acquisition,
analysis and interpretation; PR participated in manuscript drafting and in
clinical data acquisition, analysis and interpretation; SP participated in clinical
data acquisition, analysis and interpretation and in revision of the
manuscript. All authors read and approved the final manuscript.
16.
17.
18.
19.
20.
Author details
1
Department of Biomedical Sciences and of Morphological and Functional
Images, University of Messina, Messina, Italy. 2Department of Specialist
Medical-Surgical Experimental Sciences and Odontostomatology, University
of Messina, Messina, Italy. 3A.O.U “Policlinico P. Giaccone”, Palermo, Italy.
4
Department of Environment and Primary Prevention, Local Health Unit,
Messina, Italy. 5Local Health Unit, Giarre, Italy.
Received: 24 March 2013 Accepted: 31 May 2013
Published: 9 July 2013
References
1. Arakawa H, Niimi H, Kurihara Y, Nakajima Y, Webb WR: Expiratory
high-resolution CT: diagnostic value in diffuse lung diseases. AJR Am J
Roentgenol 2000, 175:1537–1543.
2. Matsuoka S, Kurihara Y, Yagihashi K, Nakajima Y: Quantitative assessment
of peripheral airway obstruction on paired expiratory/inspiratory
thin-section computed tomography in chronic obstructive pulmonary
disease with emphysema. J Comput Assist Tomogr 2007, 31:384–389.
3. Arakawa H, Webb WR: Air trapping on expiratory high-resolution CT
scans in the absence of inspiratory scan abnormalities: correlation with
pulmonary function tests and differential diagnosis. AJR Am J Roentgenol
1998, 170:1349–1353.
4. Hansell DM, Bankier AA, MacMahon H, McLoud TC, Müller NL, Remy J: Fleischner
Society: glossary of terms for thoracic imaging. Radiology 2008, 246:697–722.
5. Bankier AA, Schaefer-Prokop C, De Maertelaer V, Tack D, Jaksch P, Klepetko W,
Gevenois PA: Air trapping: comparison of standard-dose and simulated
low-dose thin-section CT techniques. Radiology 2007, 242:898–906.
6. Matsuoka S, Kurihara Y, Yagihashi K, Hoshino M, Watanabe N, Nakajima Y:
Quantitative assessment of air trapping in chronic obstructive
pulmonary disease using inspiratory and expiratory volumetric MDCT.
AJR Am J Roentgenol 2008, 190:762–769.
7. Mets OM, Buckens CF, Zanen P, Isgum I, van Ginneken B, Prokop M,
Gietema HA, Lammers JW, Vliegenthart R, Oudkerk M, van Klaveren RJ,
de Koning HJ, Mali WP, de Jong PA: Identification of chronic obstructive
pulmonary disease in lung cancer screening computed tomographic
scans. JAMA 2011, 306:1775–1781.
8. Mets OM, Zanen P, Lammers JJ, Isgum I, Gietema HA, van Ginneken B,
Prokop M, de Jong PA: Early identification of small airways disease on
lung cancer screening CT: comparison of current air trapping measures.
Lung 2012, 190:629–633.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Yamashiro T, Matsuoka S, Bartholmai BJ, San Josè Estepar R, Ross JC, Diaz A,
Murayama S, Silverman EK, Hatabu H, Wanshko GR: Collapsibility of lung
volume by paired inspiratory and expiratory CT scans: correlations with
lung function and mean lung density. Acad Radiol 2010,
17:489–495.
Kundu S, Gu S, Leader JK, Tedrow JR, Sciurba FC, Gur D, Kaminski M, Pu J:
Assessment of lung collapsibility in chronic obstructive lung disease
patients using CT. Eur Radiol 2013, 23:1564–1572.
Chung JH, Kanne JP, Gilman MD: CT of diffuse tracheal disease. AJR Am J
Roentgenol 2011, 196:W240–246.
Tanaka N, Matsumoto T, Miura G, Emoto T, Matsunaga N, Ueda K, Lynch DA:
Air trapping at CT: high prevalence in asymptomatic subjects with
normal pulmonary function. Radiology 2003, 227:776–785.
Weibel ER: Principles and methods for the morphometric study of the
lung and other organs. Lab Invest 1963, 12:131–155.
Mead J: The lung's "quiet zone". N Engl J Med 1970, 282:1318–1319.
Hogg JC, Macklem PT, Thurlbeck WM: Site and nature of airway obstruction
in chronic obstructive lung disease. N Engl J Med 1968, 278:1355–1360.
Yanai M, Sekizawa K, Ohrui T, Sasaki H, Takishima T: Site of airway
obstruction in pulmonary disease: direct measurement of intrabronchial
pressure. J Appl Physiol 1992, 72:1016–1023.
Devakonda A, Raoof S, Sung A, Travis WD, Naidich D: Bronchiolar disorders:
a clinical-radiological diagnostic algorithm. Chest 2010, 137:938–951.
Mishima M: Physiological differences and similarities in asthma and
COPD–based on respiratory function testing. Allergol Int 2009,
58:333–340.
Usmani OS, Barnes PJ: Assessing and treating small airways disease in
asthma and chronic obstructive pulmonary disease. Ann Med 2012,
44:146–156.
Sorkness RL, Bleecker ER, Busse WW, Calhoun WJ, Castro M, Chung KF,
Curran-Everett D, Erzurum SC, Gaston BM, Israel E, Jarjour NN, Moore WC,
Peters SP, Teaque WG, Wenzel SE, National Heart, Lung, and Blood Institure
Severe Asthma Research Program: Lung function in adults with stable but
severe asthma: air trapping and incomplete reversal of obstruction with
bronchodilation. J Appl Physiol 2008, 104:394–403.
Sutherland ER, Martin RJ, Bowler RP, Zhang Y, Rex MD, Kraft M: Physiologic
correlates of distal lung inflammation in asthma. J Allergy Clin Immunol
2004, 113:1046–1050.
Stanescu D: Small airways obstruction syndrome. Chest 1999, 116:231–233.
Cohen J, Postma DS, Vink-Klooster K, van der Bij W, Verschuuren E, Ten Hacken
NH, Koeter GH, Douma WR: FVC to slow inspiratory vital capacity ratio:
a potential marker for small airways obstruction. Chest 2007, 132:1198–1203.
Silva CIS, Colby TV, Müller NL: Asthma and associated conditions: high-resolution
CT and pathologic findings. AJR Am J Roentgenol 2004, 183:817–824.
Pipavath SJ, Lynch DA, Cool C, Brown KK, Newell JD: Radiologic and pathologic
features of bronchiolitis. AJR Am J Roentgenol 2005, 185:2354–2363.
D'Andrea N, Vigliarolo R, Sanguinetti CM: Respiratory involvement in
inflammatory bowel diseases. Multidiscipl Resp Med 2010, 5:173–182.
Mueller-Mang C, Grosse C, Stiebellehner L, Bankier AA: What every
radiologist should know about idiopathic interstitial pneumonias.
Radiographics 2007, 27:595–615.
Silva CIS, Churg A, Müller NL: Hypersensitivity pneumonitis: spectrum of
high-resolution CT and pathologic findings. AJR Am J Roentgenol 2007,
188:334–344.
Hawtin KE, Roddie ME, Mauri FA, Copley SG: Pulmonary sarcoidosis: the
“Great Pretender’. Clin Radiol 2010, 65:642–650.
Zhang J, Hasegawa I, Hatabu H, Feller-Kopman D, Boiselle PM: Frequency
and severity of air trapping at dynamic expiratory CT in patients with
tracheobronchomalacia. AJR Am J Roentgenol 2004, 182:81–85.
Gaeta M, Blandino A, Scribano E, Minutoli F, Barone M, Andò F, Pandolfo I:
Chronic infiltrative lung disease: value of gadolinium-enhanced MRI in
the evaluation of disease-activity. Chest 2000, 117:1173–1178.
Gaeta M, Vinci S, Minutoli F, Mazziotti S, Ascenti G, Salamone I, Lamberto S,
Blandino A: CT and MRI findings of mucin-containing tumors and
pseudotumors of the thorax: pictorial review. Eur Radiol 2002, 12:181–189.
Gaeta M, Blandino A, Scribano E, Vinci S, Minutoli F, Pergolizzi S, Pandolfo I:
Magnetic resonance imaging of bronchioloalveolar carcinoma. J Thorac
Imaging 2000, 15:41–47.
Gaeta M, Minutoli F, Ascenti G, Vinci S, Mazziotti S, Pandolfo I, Blandino A:
MR white lung sign: incidence and significance in pulmonary
consolidations. J Comput Assist Tomogr 2001, 25:890–896.
Gaeta et al. Multidisciplinary Respiratory Medicine 2013, 8:44
http://www.mrmjournal.com/content/8/1/44
Page 8 of 8
35. Gaeta M, Ascenti G, Mazziotti S, Contiguglia R, Barone M, Mileto A: MRI
differentiation of pneumonia-like mucinous adenocarcinoma and
infectious pneumonia. Eur J Radiol 2012, 81:3587–3591.
36. Fain S, Schiebler ML, McCormack DG, Parraga G: Imaging of lung function
using hyperpolarized Helium-3 magnetic resonance imaging: review of
current and emerging translational methods and applications. J Magn
Reson Imaging 2010, 32:1398–1408.
37. Holmes JH, O’Halloran RL, Brodsky EK, Bley TA, Francois CJ, Velikina JV,
Sorkness RL, Busse WW, Fain SB: Three dimensional imaging of ventilation
dynamics in asthmatics using multi-echo projection acquisition with
constrained reconstruction. Magn Reson Med 2009, 62:1543–1556.
doi:10.1186/2049-6958-8-44
Cite this article as: Gaeta et al.: Expiratory CT scan in patients with
normal inspiratory CT scan: a finding of obliterative bronchiolitis and
other causes of bronchiolar obstruction. Multidisciplinary Respiratory
Medicine 2013 8:44.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Liccardi et al. Multidisciplinary Respiratory Medicine 2013, 8:67
COMMENTARY
Open Access
Oxytocin: an unexpected risk for cardiologic and
broncho-obstructive effects, and allergic reactions
in susceptible delivering women
Gennaro Liccardi1*, Maria Beatrice Bilò2, Ciro Mauro3, Antonello Salzillo1, Amedeo Piccolo1, Maria D’Amato4,
Annabella Liccardi1 and Gennaro D’Amato1
Abstract
Oxytocin (Sintocynon) is considered an uncommon cause of severe allergic reactions during delivery. We have recently
shown that allergic sensitization to latex might constitute an important predisposing risk factor for anaphylaxis after the
first infusion of oxytocin during delivery.
Some oxytocin cardiovascular activities such as lowering blood pressure, negative cardiac inotropy and cronotropy,
parasympathetic neuromodulation, vasodilatation etc. can induce significant side effects mimicking cardiac anaphylaxis,
and constitute an additional differential diagnostic problem in delivering women with suspected or real allergic
background. Finally, some ex vivo models have shown that oxytocin, under pro-inflammatory cytokines stimulation,
such as those occurring in asthma, may induce contraction of smooth muscle and airway narrowing.
This background suggests that allergic sensitization to latex allergens constitutes a significant but underestimated risk
factor for triggering severe systemic reactions after the infusion of oxytocin and, consequently, there is a need of
particular attention in managing delivering women suffering from latex allergy and bronchial asthma. An accurate
anamnestic, clinical and diagnostic evaluation, latex-free anesthesiological setting, use of oxytocin-alternative agents
and, if necessary, a drug premedication are likely to reduce the risk of anaphylactic/broncho-obstructive reactions in
these women.
Keywords: Anaphylaxis, Bronchial asthma, Delivery, Drug allergy, Heart, Hypersensitivity, Latex allergy, Oxytocin,
Oxytocin allergy, Oxytocin and heart, Oxytocin side effects
Background and Main text
Oxytocin (Sintocynon) is usually considered an uncommon cause of severe allergic reactions during delivery.
Very few documented reports on anaphylactic/anaphylactoid reactions as well as severe airway obstruction
have been published [1-6]. However, some experimental
data highlight the possibility that the risk of developing
severe systemic reactions after the infusion of oxytocin
during delivery could be higher than expected in some
allergic women. In this context, allergic sensitization to
latex, the second most frequently incriminated substance
inducing anaphylaxis during anesthesia [7], which is also
a relatively common condition in female sex [8], might
represent an important predisposing risk factor. It is important to outline that hypersensitivity reactions in
anesthesia setting are significantly higher in adult
women than in men [9]; moreover, Draisci et al. [10]
reported a higher prevalence of latex sensitization in the
obstetric population than in non-pregnant subjects
undergoing gynaecologic surgery.
Ogata and Minami [11] demonstrated homology in the
protein sequence of oxytocin and latex allergens Hev b
7.01 and Hev b 7.02 (patatin). These authors suggested
that, in their patient sensitized to patatin, subsequent administration of oxytocin could facilitate the antigen recognition, resulting in an anaphylactic response to latex.
* Correspondence: [email protected]
1
Department of Chest Diseases, Division of Pneumology and Allergology.
High Speciality “A.Cardarelli” Hospital, Naples, Italy
Full list of author information is available at the end of the article
© 2013 Liccardi et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Liccardi et al. Multidisciplinary Respiratory Medicine 2013, 8:67
http://www.mrmjournal.com/content/8/1/67
We have recently described two life-threatening anaphylactic reactions with onset a few minutes after the infusion
of oxytocin in two women sensitized to latex allergens [12].
Both reactions occurred during caesarian section under
spinal anaesthesia in the delivery room of our Hospital.
Diagnostic procedures confirmed an IgE - mediated allergic response to both latex and oxytocin, no allergic response was found to other agents used before or during
caesarian section such as local antiseptics, proton-pump
inhibitors, antihypertensive drugs, low molecular weight
heparin (enoxaparin sodium), human albumin.
In view of the few data available in literature, we believe that this topic is underestimated because such adverse events might be easily attributed to latex allergy or
to usual “side effects” or alternative/unknown causes.
Moreover, this risk could be underestimated if we consider that female sex shows higher prevalence of both
hypersensitivity reactions in the anesthesia setting and
latex allergy than men.
Among the possible “side effects”, it is important to outline the role of oxytocin on heart [13].
It has been shown that both oxytocin and its receptors
are found in the heart and large vessels [14], where accumulating evidence demonstrates cardio protective effects
such as natriuresis, altered insulin liberation and antidiabetic actions, antioxidant actions, inhibition of inflammation, stimulation of endothelial markers in mesenchymal cells and stem cells [15-18].
However, several other cardiovascular activities such as
lowering blood pressure, negative cardiac inotropy and
cronotropy, parasympathetic neuromodulation, vasodilatation etc. which may be beneficial in some clinical conditions, can induce significant side effects during delivery
Page 2 of 4
[13]. These side effects mimicking cardiac anaphylaxis represent an additional differential diagnostic problem in delivering women with suspected or real allergic background
[19] (Figure 1). In this context it is important to outline the
necessity of serum tryptase determination to confirm the
diagnosis of anaphylaxis.
Oxytocin induces uterine contractions during delivery
and milk ejection during lactation through activation of
a specific G protein-coupled receptor [20]. The expression of this receptor increases before the onset of labour
highlighting uterine muscle sensitivity and promoting
myometrial shortening.
Interestingly, it has been shown that the expression of
oxytocin receptors plays a role not only in uterine but
also in other human tissues such as kidney, ovary, heart,
vascular endothelium etc. Labour and inflammation increase the expression of oxytocin receptors in human
amnion [21], inflammatory conditions may also increase
the production of oxytocin receptors in cultivated primary uterine smooth muscle cells [22].
Recently oxytocin receptors have been found also in
human airway smooth muscle [23]. Moreover, Amrani
et al. [24] have shown that asthma-related cytokines (IL13 and TNF alpha) modulate the expression of oxytocin
receptors in human airway smooth muscle function
suggesting a potential role of inflammation-induced
changes in oxytocin receptor signaling in the regulation of
airway hyper-responsiveness in asthma. In other words, in
this ex vivo model, oxytocin, under pro-inflammatory cytokines stimulation, may induce contraction of smooth
muscle and airway narrowing suggesting that oxytocin
serves as a bronchoconstrictor [24]. As a confirmation of
this possibility, a case of exclusive severe airway
CARDIO- PROTECTIVE EFFECTS OF OXYTOCIN
In delivering women with allergic background
Natriuresis
Negative inotrophic and chronotrophic effects
Lowering blood pressure
Vasodilatation
Oxytocin side effects ?
or
Cardiac anaphylaxis ?
Parasympathetic neuromodulation
Altered insulin liberation and anti-diabetic effects
Antioxidant activity
Inhibition of inflammation
Stimulation of endothelial markers in mesenchymal and stem cells
Angiogenic effect
Anti-apoptotic effect
Figure 1 Cardio protection and anaphylactic-like effects of oxytocin.
Intraoperative
diagnostic problem
Liccardi et al. Multidisciplinary Respiratory Medicine 2013, 8:67
http://www.mrmjournal.com/content/8/1/67
Page 3 of 4
involvement (bronchospasm and laryngeal stridor) after
oxytocin administration has also been reported [25].
Taken together, these data suggest that inflammatory
conditions of airways such as those found in asthmatic
women might constitute an independent (from anaphylaxis) risk factor for airway obstruction after infusion of
oxytocin during delivery. The role of oxytocin receptors
could also explain the well known worsening of asthma
control in about one-third of pregnant women suffering
from asthma [26-28].
Finally, Gonzalez-Perez et al. have shown that women
suffering from severe asthma are at higher risk of anaphylaxis than men [29], as a consequence the risk of developing anaphylaxis, asthma exacerbation or both is
likely high in severe asthmatic women (Figure 2).
Since oxytocin causes the alveoli in the breasts to contract causing milk let-down as the milk ejection reflex,
there is some controversy over whether or not a woman
can be “allergic to breastfeeding”. In fact there are
women who have allergy-like symptoms associated with
the milk ejection reflex during breastfeeding. These
symptoms can include itching, redness, rash or hives on
the trunk, arms or legs, anaphylactic reactions as they
have been also shown [30]. It has been suggested that
these symptoms can also represent adverse reactions to
the synthetic forms of oxytocin. Systemic reactions to
preservatives contained in preparations of oxytocin has
been also described [31].
Although in vivo tests with oxytocin have not been standardized, a diluted/undiluted oxytocin solution should be
used by skin prick test/intradermal test. In our case report,
both patients reacted after the use of skin prick test and,
consequently, intradermal test was not necessary [12].
Latex hypersensitivity should be excluded by using
in vivo (skin prick tests) and in vitro (evaluation of specific IgE antibodies by classic or, if possible, micro-array
technique) tests.
Conclusions
In conclusion, our findings suggest a particular attention
in managing delivering women suffering from latex allergy
and bronchial asthma. An accurate anamnestic, clinical
and diagnostic evaluation, latex-free anesthesiological setting, use of oxytocin-alternative agents and, if suffering
from asthma, a drug premedication [32] are likely to reduce the risk of anaphylactic or airway-obstructive reactions in these women.
Further in vitro studies are necessary to establish the
occurrence of an immunological cross-reaction between latex and oxytocin as well as the role of oxytocin
and its receptors in heart and airway. Finally, further
clinical studies should be designed to a better understanding/management of respiratory and cardiac effects
of oxytocin administration.
Summary statement
Oxytocin may constitute a risk factor for anaphylaxis,
bronchial asthma and cardiologic side effects in delivering women.
ASSOCIATED CONDITIONS
Sensitization to
Latex
Sensitization to
Airway inflammation
Oxytocin
(asthma)
Anaphylaxis
- Accurate pre-delivery allergy evaluation (e.g.
latex, latex cross-reacting fruits etc.)
- Use of latex- free surgical materials
- Use of Oxytocin-alternative agents
- Premedication in high risk allergic subjects ?
Bronchospasm
- Pre- delivery evaluation of asthma
control and, if necessary, integration with
usual anti- asthma drugs (30)
- In the case of poor or non-controlled
asthma, a drug supplementation just
before delivery could be necessary (30)
Figure 2 Suggested correlation between latex, oxytocin sensitization and airway inflammatory conditions.
Liccardi et al. Multidisciplinary Respiratory Medicine 2013, 8:67
http://www.mrmjournal.com/content/8/1/67
Competing interest
All authors declare that they have no conflict of interest and that the study
has been carried out without any financial support.
Author details
1
Department of Chest Diseases, Division of Pneumology and Allergology.
High Speciality “A.Cardarelli” Hospital, Naples, Italy. 2Allergy Unit, Department
of Immunology, Allergy and Respiratory Diseases, University Hospital,
Ancona, Italy. 3Division of Cardiology, Cardiac Intensive Care and
Hemodynamic. Department of Intensive Care, High Speciality “A.Cardarelli”
Hospital, Naples, Italy. 4Department of Respiratory Disease, University
“Federico II” University – AO “Dei Colli”, Naples, Italy.
Received: 24 June 2013 Accepted: 25 September 2013
Published: 20 October 2013
References
1. Lin MC, Hsieh TK, Liu CA, Chu CC, Chen JY, Wang JJ, Shieh JP:
Anaphylactoid shock induced by oxytocin administration- a case report.
Acta Anaesthesiol Taiwan 2007, 45:233–236.
2. Shimo T, Nishiite S, Masuoka M, Seki S, Tsuchida H: Intraoperative
anaphylactic shock induced by methylergometrine and oxytocin.
Masui 2006, 55:447–450.
3. Spears FD, Liu DW: Anaphylactoid reaction to syntocinon? Anaesthesia
1994, 49:41–43.
4. Morriss WW, Lavies NG, Anderson SK, Southgate HJ: Acute respiratory
distress during caesarean section under spinal anaesthesia. A probable
case of anaphylactoid reaction to Syntocinon. Anaesthesia 1994, 49:41–43.
5. Maycock EJ, Russell WC: Anaphylactoid reaction to Syntocinon.
Anaesth Intensive Care 1993, 21:211–212.
6. Marmo D, Sacerdoti C, Di Minno RM, Guarino I, Villani R, Di Iorio C:
Anaphylactic shock during hyperbaric oxygen therapy. Undersea Hyperb
Med 2012, 39:613–18.
7. Mertes PM, Alla F, Trechot P, Auroy Y, Jougla E: Anaphylaxis during
anesthesia in France: a 8-year national survey. J Allergy Clin Immunol 2011,
128:366–73.
8. Lieberman P: Anaphylactic reactions during surgical and medical
procedures. J Allergy Clin Immunol 2002, 110:S64–S69.
9. Mertes PM, Demoly P, Malinovsky JM: Hypersensitivity reactions in the
anesthesia setting/allergic reactions. Curr Opin Allergy Clin Immunol 2012,
12:361–368.
10. Draisci G, Zanfini BA, Nucera E, Catarci S, Sangregorio R, Schiavino D,
Mannocci A, Patriarca G: Latex sensitization. A special risk for the
obstetric population? Anesthesiology 2011, 114:565–569.
11. Ogata J, Minami K: Synthetic oxytocin and latex allergy. Br J Anaesth 2007,
98:845–846.
12. Liccardi G, Bilò M, Mauro C, Salzillo A, Piccolo A, D’Amato M, D’Amato G:
Oxytocin: a likely underestimated risk for anaphylactic reactions in
delivering women sensitized to latex. Ann Allergy Asthma Immunol 2013,
110:465–466.
13. Gutkowska J, Jankowski M: Oxytocin revisited: its role in cardiovascular
regulation. J Neuroendocrinol 2012, 24:599–608.
14. Jankowski M, Wang D, Hajjar F, Mukaddam-Daher S, Hoffman G, McCann
SM, Gutkowska J: Oxytocin and its receptors are synthesized in the rat
vasculation. Proc Natl Acad Sci USA 2000, 97:6207–6211.
15. Soares TJ, Coimbra TM, Martius AR, Pereira AG, Camio EC, Branco LG,
Albuquerque-Aranjo WI, De Nucci G, Favaretto AL, Gutkowska J, McCann
SM, Antunes-Rodrigues J: Atrial natriuretic peptide and oxytocin induce
natriuresis by release of cGMP. Proc Natl Acad Sci USA 1999, 96:278–283.
16. Florian M, Jankowski M, Jankowski M: Oxytocin increases glucose uptake
in neonatal rat cardiomyocytes. Endocrinology 2010, 151:482–491.
17. Iseri SO, Sener G, Saglan B, Gedik N, Ercan F, Yegen BC: Oxytocin
ameliorates oxidative colonic inflammation by a neutrophil-dependent
mechanism. Peptides 2005, 26:483–491.
18. Kim YS, Kwon JS, Hong MH, Kim J, Song CH, Jeon MH, Cho JG, Park JC,
Kang JC, Ahn Y: Promigratory activity of oxytocin in umbilical cord bloodderived mesenchymal stem cells. Artif Organs 2010, 34:453–461.
19. Triggiani M, Patella V, Staiano RI, Granata F, Marone G: Allergy and
cardiovascular system. Clin Exp Immunol 2008, 153(Suppl 1):7–11.
20. Gimpl G, Fahrenholz F: The oxytocin receptor system: structure, function
and regulation. Physiol Rev 2001, 81:629–683.
Page 4 of 4
21. Terzidou V, Blanks AM, Kim SH, Thornton S, Bunnett PR: Labor and
inflammation increase the expression of oxytocin receptor in human
amnion. Biol Reprod 2011, 84:546–552.
22. Helmer H, Tretzmuller U, Brunbauer M, Kaider A, Husslein P, Knofler M:
Production of oxytocin receptor and cytokines in primary uterine
smooth muscle cells cultivated under inflammatory conditions. J Soc
Gynecol Investig 2002, 9:15–21.
23. Pequeux C, Breton C, Hagelstein MT, Geenen V, Legros JT: Oxytocin
receptor pattern of expression in primary lung cancer and in normal
human lung. Lung Cancer 2005, 50:177–188.
24. Amrani Y, Syed F, Huang C, Li K, Liu V, Jain D, Keslacy S, Sims MW, Baidouri H,
Cooper PR, Zhao H, Siddiqui S, Brightling CE, Griswold D, Li L, Panettieri RS Jr:
Expression and activation of the oxytocin receptor in airway smooth
muscle cells: Regulation by TNFalpha and IL-13. Respir Res 2010, 11:104.
25. Cabestrero D, Perez-Paredes C, Femandez-Cid R, Arribas MA:
Bronchospasm and laryngeal stridor as an adverse effect of oxytocin
treatment. Crit Care 2003, 7:392.
26. Liccardi G, Cazzola M, Canonica GW, D’Amato M, D’Amato G, Passalacqua G:
General strategy for the management of bronchial asthma in pregnancy.
Respir Med 2003, 97:778–789.
27. Namazy JA, Schatz M: Asthma and pregnancy. J Allergy Clin Immunol 2011,
128:1384–1385.
28. McCallister JW: Asthma in pregnancy: management strategies. Curr Opin
Pulm Med 2013, 19:13–17.
29. Gonzalez-Perez A, Aponte Z, Fernandez Vidaurre C, Garcia Rodriguez LA:
Anaphylaxis epidemiology in patients with and without asthma: a United
Kingdom database review. J Allergy Clin Immunol 2010, 125:1098–1104.
30. Shank JJ, Olney SC, McNamara MF: Recurrent postpartum anaphylaxis
with breast-feeding. Obstet Gynecol 2009, 114:415–416.
31. Hofman H, Goerz G, Plewig G: Anaphylactic shock from chlorobutanolpreserved oxytocin. Contact Dermatitis 1986, 15:241.
32. Liccardi G, Salzillo A, Sofia M, D’Amato M, D’Amato G: Bronchial asthma.
Curr Opin Anesthesiol 2012, 25:30–37.
doi:10.1186/2049-6958-8-67
Cite this article as: Liccardi et al.: Oxytocin: an unexpected risk for
cardiologic and broncho-obstructive effects, and allergic reactions in
susceptible delivering women. Multidisciplinary Respiratory Medicine
2013 8:67.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Yakar et al. Multidisciplinary Respiratory Medicine 2013, 8:13
http://www.mrmjournal.com/content/8/1/13
CASE REPORT
Open Access
Isoniazid- and rifampicin-induced
thrombocytopenia
Fatih Yakar1*, Namşan Yildiz2, Aysun Yakar3 and Zeki Kılıçaslan2
Abstract
Treatment of tuberculosis has many side effects. Thrombocytopenia is a serious side effect of such treatment and
occurs mostly due to rifampicin (RIF). There are very few reported cases of thrombocytopenia due to isoniazid
(INH). An 18-year-old female patient was diagnosed with smear-positive pulmonary tuberculosis. A four-drug
regimen [INH, RIF, ethambutol (EMB), and pyrazinamide (PZA)] was given. After the development of
thrombocytopenia, the drug treatment was stopped, and a thrombocyte suspension was given until a normal
thrombocyte count was obtained. After several start-stop trials, first INH and then RIF were identified as the possible
causes of thrombocytopenia and were removed from the regimen. The patient was treated with EMB,
streptomycin, PZA, and moxifloxacin with no further development of thrombocytopenia. The current case shows
that antituberculosis drugs other than RIF and PZA may be responsible for the development of thrombocytopenia.
Keywords: Drug toxicity, Thrombocytopenia, Tuberculosis
Background
Tuberculosis is a chronic granulomatous infection that has
caused mortality and morbidity for centuries. Treatment of
this disease is problematic because of its long duration and
compliance problems. One of the most important factors
causing low compliance is the adverse effects of the drugs.
Some of them are self-limiting, but some require treatment
cessation. Common adverse effects are hepatotoxicity,
hypersensitivity reactions, loss of vision, loss of hearing,
flu-like syndrome, hemolytic anemia, acute renal failure,
shock, neuropathy, arthralgia, and thrombocytopenia [1].
Although rare, severe thrombocytopenia may be lifethreatening. Here we describe the case of a patient affected
with thrombocytopenia caused by isoniazid (INH) and rifampicin (RIF).
Case presentation
An 18-year-old female with no known disease history was
admitted to another center with complaints of coughing
with sputum and weight loss. Chest x-ray and microscopic
examination of the sputum enabled a diagnosis of smearpositive pulmonary tuberculosis. A four-drug regimen
* Correspondence: [email protected]
1
Department of Pulmonary Medicine, Bezmialem Vakif University, 34093,
Fatih, Istanbul, Turkey
Full list of author information is available at the end of the article
(INH, 300 mg/day; RIF, 450 mg/day; ethambutol [EMB],
1,250 mg/day; and pyrazinamide [PZA], 1,500 mg/day)
was started according to her weight of 50 kg. While normal at the start of therapy (300,000/mm3), her thrombocyte count began to decrease during the second day of
treatment (18,000/mm3). The therapy was stopped, and
after transfusions of fresh frozen plasma and a thrombocyte suspension, her thrombocyte count became normal.
Rifampicin was assumed to be the causative factor of
thrombocytopenia, and therapy was restarted with INH,
PZA, and EMB. However, thrombocytopenia relapsed
during this regimen. The treatment was stopped and the
patient was referred to our hospital.
When the patient was admitted to our hospital, her main
complaint was coughing. No important previous history
was present. Physical examination findings were normal
with the exception of bilateral ecchymoses on her lower
extremities. Chest X-ray showed a cavity with peripheral
infiltration in the left upper zone. Laboratory findings
revealed; sedimentation rate: 46 mm/hr, CRP: 24 mg/lt,
WBC: 9,910/mm3, hemoglobin: 10 gr/dl, hematocrit: 31%,
and thrombocytes: 135,000/mm3. Other parameters were
noncontributory.
Because of the recurrent thrombocytopenia, we planned
to start a treatment with a single agent and add the others
one by one. The treatment was initiated in our hospital with
© 2013 Yakar et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Yakar et al. Multidisciplinary Respiratory Medicine 2013, 8:13
http://www.mrmjournal.com/content/8/1/13
INH at 300 mg/day, but this resulted in thrombocytopenia
(30,000/mm3) on the third day, and the therapy was
stopped. As soon as the thrombocyte count became normal, we began a three-drug regimen according to the
patient’s weight: PZA, 1,500 mg/day; streptomycin (SM),
750 mg/day; and EMB, 1,250 mg/day. Because the thrombocyte count was normal (225,000/mm3), INH was again
added to the regimen, but on the second day of INH initiation, the thrombocyte count decreased to 10,000/mm3.
The INH was stopped and the patient underwent a consultation in the Hematology Department. Then a thrombocyte
suspension and methylprednisolone (1 mg/kg/day) were
given. During the follow up, the thrombocyte count became
normal and the methylprednisolone therapy was stopped.
After re-initiation of the three-drug regimen (EMB, PZA,
and SM), RIF at 450 mg/day was added to the therapy as
the fourth drug. On the third day of RIF therapy, the
thrombocyte count decreased to 34,000/mm3 and RIF was
ceased.
Because of thrombocytopenia caused by both INH and
RIF, moxifloxacin at 400 mg/day was added to the treatment regimen. Without INH and RIF, patient had no
further thrombocytopenia development during the
period of therapy. After the first month of the therapy,
her sputum smear was negative. There were no clinical
or laboratory abnormalities during follow up examinations. After cessation of SM in the second month, the
antituberculosis treatment regimen was continued and
completed with three drugs (EMB, 1250 mg/day; PZA,
1500 mg/day; and moxifloxacin, 400 mg/day) without
any further complications.
Discussion and conclusions
Although there are reports of thrombocytopenia during
antituberculosis treatment, only few case reports of
INH-induced thrombocytopenia are reported [2-5], but
none where the hematologic disorder was at the same
time caused by INH and RIF. Our patient had recurrent
episodes of thrombocytopenia due to INH and RIF, either together or separately.
A thrombocyte count of <150,000/mm3 is defined as
thrombocytopenia. However, 2.5% of the normal population
may have thrombocyte levels lower than this value [6]. The
main mechanisms of thrombocytopenia are decreased production or increased destruction. Moreover, dilutional and
distributional mechanisms may contribute. Before diagnosing thrombocytopenia, pseudothrombocytopenia, which
may occur due to ineffective anticoagulation in blood tubes,
thrombocyte clustering, or abciximab use, should be
excluded [7]. In our patient, pseudothrombocytopenia was
excluded with a peripheral blood smear examination.
Drug-induced thrombocytopenia is a frequent condition. George et al. collected case reports of drug-induced
thrombocytopenia and defined the standard criteria with
Page 2 of 3
whom to explain the association between the drugs and
thrombocytopenia [8]. They defined four criteria: 1) the
suspected drug preceded thrombocytopenia and recovery
was complete and sustained after the drug withdrawal 2)
The suspected drug was the only drug used prior to the
onset, or other drugs were continued or reintroduced after
discontinuation of the suspected drug with a sustained
normal thrombocyte count. 3) Other etiologies of
thrombocytopenia were excluded. 4) Re-exposure to the
suspected drug resulted in recurrent thrombocytopenia. If
the suspected drug meets all criteria, then the level of evidence is definite. If it meets the first three, it is probable; if
it meets only the first criterion, it is possible; and if the
first criterion is not met, then it is unlikely that it is the responsible agent. According to these criteria, both INH
and RIF in our patient met all of the criteria, and so the
level of evidence was definite.
Clinical findings usually appear when the thrombocyte
count decreases under a certain level. When thrombocytes
are lower than 20,000/mm3, spontaneous bleeding and ecchymoses may appear. There were ecchymoses on both
lower extremities of the present patient at admittance. RIF
is the most common cause of thrombocytopenia among
antituberculosis drugs. The drug binds noncovalently to
membrane glycoproteins to produce compound epitopes
or induce conformational changes for which antibodies
are specific [8]. In addition, RIF-dependent antibodies attach to thrombocytes and cause increased destruction.
INH is a synthetic chemical and a pyridine derivative of
nicotinamide. The central nervous system, liver, and
hematological system are the main targets of INH toxicity.
It may induce acute or chronic disturbances of the
hematological system. Acutely it may cause leukocytosis,
and chronically it may determine anemia (hemolytic, sideroblastic, aplastic, or megaloblastic), agranulocytosis, eosinophilia, or thrombocytopenia; disseminated intravascular
coagulation and lymphadenopathy due to hypersensitivity
reactions have also been reported [9]. The exact mechanism
of INH-induced thrombocytopenia is not known.
Although INH-induced thrombocytopenia has been
defined previously, there are only four previous cases in
the literature, none of which was also RIF-induced. INHand RIF-induced thrombocytopenia in the present case
was diagnosed by the occurrence of thrombocytopenia
due to RIF in the treatment regimen without INH as well
as thrombocytopenia due to INH in the regimen without
RIF and exclusion of other potential diagnoses by a peripheral blood smear. Nevertheless, thrombocytopenia is
rare but life-threatening. Early recognition and cessation
of treatment may prevent mortality and morbidity.
Consent
Written informed consent was obtained from the patient for
publication of this report and any accompanying images.
Yakar et al. Multidisciplinary Respiratory Medicine 2013, 8:13
http://www.mrmjournal.com/content/8/1/13
Page 3 of 3
Competing interests
The authors declare that they have no competing interests.
Author details
1
Department of Pulmonary Medicine, Bezmialem Vakif University, 34093,
Fatih, Istanbul, Turkey. 2Department of Pulmonary Medicine,
IstanbulUniversity, Istanbul Medical Faculty, Istanbul, Turkey. 3Department of
Pulmonary Medicine, Malatya State Hospital, Malatya, Turkey.
Received: 30 October 2012 Accepted: 28 January 2013
Published: 13 February 2013
References
1. Blumberg HM, Burman WJ, Chaisson RE, Daley CL, Etkind SC, Friedman LN,
Fujiwara P, Grzemska M, Hopewell PC, Iseman MD, Jasmer RM, Koppaka V,
Menzies RI, O'Brien RJ, Reves RR, Reichman LB, Simone PM, Starke JR,
Vernon AA, American Thoracic Society, Centers for Disease Control and
Prevention and the Infectious Diseases Society: American thoracic society/
centers for disease control and prevention/infectious diseases society of
America: treatment of tuberculosis. Am J Respir Crit Care Med 2003,
167:603–662.
2. Guy C, Broyet C, Albengres E, Berthoux F, Ollagnier M: Thrombopenia
caused by isoniazid. Therapie 1993, 48(5):490–491.
3. Schlegel H, Sadoun D, Le Roux G, Guillevin L, Battesti JP: Thrombopenia
induced by isoniazid. Ann Med Interne (Paris) 1991, 142(8):630.
4. Hansen JE: Hypersensitivity to isoniazid with neutropenia and
thrombocytopenia. Am Rev Respir Dis 1961, 83:744–747.
5. Laub DR Jr: Isoniazid causing drug-induced thrombocytopenia. Eplasty
2011, 11:ic10.
6. Buckley MF, James JW, Brown DE, Whyte GS, Dean MG, Chesterman CN,
Donald JA: A novel approach to the assessment of variations in the
human platelet count. Thromb Haemost 2000, 83(3):480–484.
7. Landaw SA, George JN: Approach to the adult patient with
thrombocytopenia. UpToDate version 19.3. Last topic update 27 September,
2011; 2011. http://www.uptodate.com/contents/approach-to-the-adultpatient-with-thrombocytopenia.
8. George JN, Raskob GE, Shah SR, Rizvi MA, Hamilton SA, Osborne S,
Vondracek T: Drug induced thrombocytopenia a systematic review of
published case reports. Ann Intern Med 1998, 129:886–890.
9. Isoniazid drug information: International Programme on Chemical Safety,
Poisons Information Monograph 288. http://www.inchem.org/documents/
pims/pharm/pim288.htm. Last accessed February 11, 2013.
doi:10.1186/2049-6958-8-13
Cite this article as: Yakar et al.: Isoniazid- and rifampicin-induced
thrombocytopenia. Multidisciplinary Respiratory Medicine 2013 8:13.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Campisi et al. Multidisciplinary Respiratory Medicine 2013, 8:15
http://www.mrmjournal.com/content/8/1/15
CASE REPORT
Open Access
Type I Arnold-Chiari malformation with
bronchiectasis, respiratory failure, and sleep
disordered breathing: a case report
Raffaele Campisi1,2*, Nicola Ciancio1, Laura Bivona1, Annalisa Di Maria3 and Giuseppe Di Maria1
Abstract
Arnold Chiari Malformation (ACM) is defined as a condition where part of the cerebellar tissue herniates into the
cervical canal toward the medulla and spinal cord resulting in a number of clinical manifestations. Type I ACM
consists of variable displacement of the medulla throughout the formamen magnum into the cervical canal, with
prominent cerebellar herniation.
Type I ACM is characterized by symptoms related to the compression of craniovertebral junction, including ataxia,
dysphagia, nistagmus, headache, dizziness, and sleep disordered breathing. We report a case of a life-long nonsmoker, 54 years old woman who presented these symptoms associated with bronchiectasis secondary to recurrent
inhalation pneumonia, hypercapnic respiratory failure, and central sleep apnea (CSA).
CSA was first unsuccessfully treated with nocturnal c-PAP. The subsequent treatment with low flow oxygen led to
breathing pattern stabilization with resolution of CSA and related clinical symptoms during sleep. We suggest that
in patients with type I ACM the presence of pulmonary manifestations aggravating other respiratory disturbances
including sleep disordered breathing (SDB) should be actively investigated. The early diagnosis is desirable in order
to avoid serious and/or poorly reversible damages.
Keywords: Arnold-Chiari malformation, Bronchiectasis, Central sleep apnea, Oxygen therapy, Respiratory failure,
Sleep disordered breathing
Background
Arnold-Chiari malformation (ACM) is a complex syndrome in which the brainstem medulla, and the cerebellar tonsils and vermis herniate throughout the foramen
magnum [1]. Type I ACM is defined by the herniation
of only the medulla and cerebellar tonsils whereas type
II ACM is also characterized by caudal displacement of
the cerebellar vermis [2]. The main symptoms include
ataxia, dizziness, chronic headache, nystagmus, twitching,
oropharyngeal dysfunction, recurrent respiratory infections,
paresthesia, pyramidal signs and sleep disordered breathing
(SDB) encompassing a number of sleep disturbances
characterized by apneas or hypopneas, intermittent hypoxaemia, microarousals, and disruption of sleep continuity
* Correspondence: [email protected]
1
Pneumology Unit Policlinico “G. Rodolico”, University of Catania, Via Santa
Sofia 78, 95123, Catania, Italy
2
Respiratory Diseases, Università di Catania, Catania, Italy
Full list of author information is available at the end of the article
[3]. All these disturbances are related to the compression of respiratory centers and their neural pathways
related to herniation [4]. We report a case of type I ACM
with recurrent aspiration-induced pneumonia, secondary
bronchiectasis, respiratory failure, and central sleep apneas.
Case report
A 54-years-old woman with type I ACM (BMI 19.2 kg/m2,
neck and waist circumference 34 and 65 cm respectively,
Mallampati score 2), was referred to our Respiratory Unit
with a history of chronic cough and purulent sputum,
fever, intense dyspnoea (MRC dyspnoea scale 4), hoarseness, excessive daytime sleepiness (Epworth Sleepiness
Scale 14), involuntary naps, snoring, nocturia and morning
headaches. These respiratory symptoms had been present
for more than five years. She referred six hospital
admissions because of inhalation pneumonia in the last
five years. Physical examination revealed normal pulse rate
(66 per minute), high respiratory rate (24 per minute),
© 2013 Campisi et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Campisi et al. Multidisciplinary Respiratory Medicine 2013, 8:15
http://www.mrmjournal.com/content/8/1/15
normal blood pressure (115/70 mmHg) and low oxygen
saturation (SpO2 90%). Cardiac auscultation was normal,
whereas pulmonary auscultation revealed diffuse rales
in both lungs, basal and bilateral crackles. Neurologic
examination showed nistagmus, tongue twitching, dysarthria, dizziness, walking ataxia, severe dysphagia and
persistent bilateral abductor vocal cord paralysis. Routine blood tests gave normal results apart from high
level of C-reactive protein (5.68 mg/dl), ESR (64 mm)
and low serum albumin (3.3 g/dl). Cervico-medullary
magnetic resonance imaging showed cerebellar tonsils
herniation through the foramen magnum to the level of
C2 vertebra, basilar imprint and bulbar compression
[Figure 1]. Chest X-Ray showed no pulmonary consolidation whereas several cylindrical bronchiectasis of both
lungs were seen on chest CT [Figure 2]. All causes for
congenital bronchiectasis were excluded. The patient
had no family history of cystic fibrosis, α1-antitrypsin
deficiency, or other conditions that predispose to the
onset of secondary bronchiectasis such as tuberculosis
or infection during childhood. Sputum smear for acid
fast bacilli and Quantiferon-TB test were negative. Arterial PO2, PCO2 and pH were 58, 50 mmHg, and
7.43 respectively. Pulmonary function test revealed
volumes within normal limits [FVC 2,13 L (88% pred),
FEV11,67 L (93% pred), FEV1/FVC ratio 0.78. The diffusion capacity of the lung for CO (DLco): 103% pred;
DLco/VA 1.47 (110% pred.). Because of excessive daytime sleepiness, heavy snoring and hypercapnic respiratory failure we performed overnight polysomnography
in room air, after titration of c-PAP (9 cm H2O),
and during nasal oxygen administration (FiO2 0,24%)
Figure 1 Sagittal craniocervical magnetic resonance imaging
section. The arrow shows cerebellar tonsils herniation trough the
foramen magnum until the second cervical vertebra and
bulbar compression.
Page 2 of 5
Figure 2 Bronchiectasis. The arrows show cylindrical
bronchiectasis spread to both lungs appearing as “signet ring”.
overnight. These consisted of recording of airflow, pulse
oximetry, thoracic and abdominal movements, heart
rate, body position, snoring, legs positions and twochannel electroencephalogram. Apneas, hypopneas, and
apnea-hypopnea index (AHI) were defined according to
current criteria [5,6]. Polysomnography in room air
revealed an AHI of 42 events h-1 with several prolonged
episodes of Central Sleep Apneas (CSA) and some
events of obstructive sleep apnea (OSA) and an average
of arterial saturation of 89% [Figure 3]. The patient did
not show any cardiovascular comorbidity (normal echocardiogram, no signs of pulmonary hypertension or
cardiac arrhythmias).
After titration of c-PAP , polysomnography showed a
decrease in AHI from 42 to 22 events h-1 and mean of
SpO2 was 92%. Registration during nasal oxygen administration revealed a reduction in the number of both
CSA and OSA allowing a significant improvement of
AHI along with apnoea duration; mean SpO2 was 96%
[Table 1]. Capnography was performed to evaluate
changes in nocturnal hypercapnia. Average pCO2 was 52
mmHg (range 44–56 mmHg). Average SpO2 was 89%.
During low-flow nocturnal oxygen (FiO2 0,24%) pCO2
was 57 mmHg (range 53-63 mmHg); average SpO2 was
96%. During wakefulness the patient returned to be
hypercapnic with values similar to baseline, then worsening
of average pCO2 was only partial and transitory. The
patient did not take any drug known to alter the sleep
pattern. Administration of broad-spectrum antibiotics
(piperacillin/tazobactam 4,5 g/t.i.d and Ciprofloxacin
500 mg b.i.d.] was started, and corticosteroid (prednisone 25 mg/die) was administered for 7 days. During follow up examination, the patient was clinically improved,
with regression of cough, sputum, improvement in respiratory symptoms and daytime sleepiness (ESS 5), but
persistent hypercapnic chronic respiratory failure.
Campisi et al. Multidisciplinary Respiratory Medicine 2013, 8:15
http://www.mrmjournal.com/content/8/1/15
Page 3 of 5
Flow
Chest
Abdomen
Figure 3 Central sleep apnoeas. Flow, chest and abdomen pattern during central sleep apnoeas.
Discussion
This case presentation offers the opportunity to speculate about the occurrence of respiratory involvement and
its mechanisms in patients with type I ACM. Sleep
disordered breathing is associated with ACM and generally ascribed to two types of abnormalities: upper airway
dysfunctionwhich is associated with obstructive apneas,
and abnormalities of respiratory controlwhich is presumably involved in the pathophisiology of central sleep
apneas [4,7]. The latter are characterized by transient
cessation of neural respiratory output during sleep
resulting in poor ventilation and impaired gas exchange
[8]. The transient cessation of respiratory drive could be
due to: firstly, an outright defect in respiratory drive;
Table 1 Polysomnographic data at baseline, during C-PAP
breathing, and during continuous oxygen administration
Polysomnographical data
Baseline
C-PAP
FiO2 24%
Polysomnography
Total Sleep Time
7 h 03 m
7 h 40 m
7 h 30 m
Sleep onset latency
18.8 m
21.3 m
18.8 m
% Sleep efficiency
89
90
92
% Slow Wave Sleep
27
31
33
19
22
25
% REM
Respiratory Events
AHI
42
22
1
AC
125
63
3
AO
1
9
1
AM
9
0
0
HI
186
77
1
CH
175
72
3
OH
11
5
0
O2 saturation
89%
92%
96%
ODI
43
15.7
3.0
cT90
30%
21%
0%
Nadir SaO2
82
84
90
AHI Apnoea/hypopnoea index, AC Central apnea, AO Obstructive apnoea, AM
Mixed apnoea, HI Hypopnoea; CH Central Hypopnoea, OH Obstructive
Hypopnoea, ODI Oxygen Desaturation Index, cT90 percentage of sleep time
spent with SaO2 below the threshold of 90%; SaO2: arterial saturation; REM
Rapid Eye Movements.
secondly, a transient instability in an otherwise intact
respiratory control system; and thirdly, a transient active
inhibition of respiratory motor drive [9]. In addition,
patients may be either hypercapnic or non-hypercapnic.
The hypercapnic group, which includes patients with
central hypoventilation and a number of neurological
syndromes, is consistent with the first pathophysiological mechanism. The non-hypercapnic group includes
patients with idiopathic hyperventilation and periodic
breathing. Pathophysiologically this group is consistent
with the second or third mechanism. These patients typically have a low or normal awake pCO2 [10]. In OSA,
pharyngeal anatomy, upper airway muscles responsiveness
during sleep, arousal threshold, and loop gain may all contribute to the occurrence of apnea presence and severity
of central apneas. During sleep reflex muscles activation is
reduced and if the airway anatomy is quite deficient will
likely lead to substantial or complete airflow obstruction,
yielding a hypopnoea or apnea [11]. The patient had the
hypercanic form of CSA The risk of apnoea resulted
from both obstructive (short neck, limited mobility of
soft palate and tongue) and central causes. Central
causes may include: 1) compromised vascular supply to
the brainstem due to compression; 2) insensitivity of
peripheral chemo-receptors, due to brainstem involvement; 3) direct compression of the respiratory centre
[11]. In our case both central and obstructive apneas
was confirmed with polysomnography. Nasal c-PAP (9
cmH2O), after proper titration, was partially effective
in improving the AHI and apnea duration, but limited
compliance to the treatment. Polysomnography was
repeated during low flow oxygen administration
resulting in a significant reduction in both number and
duration of CSA and an increase in SpO2 (average apnea
duration in baseline condition 16.5 seconds; after low
flow oxygen administration 11.2 sec). The use of supplemental low flow oxygen, as mentioned in another case report of a patient with primary alveolar hypoventilation,
chronic hypercapnia and CSA, led to a decrease in number and duration of central apneas [11,12]. The improvement produced by oxygen may have been due to the fact
that the patient had no demonstrable ventilatory response
to hypoxia during wakefulness, and therefore may have
developed hypoxic brainstem depression during sleep. The
Campisi et al. Multidisciplinary Respiratory Medicine 2013, 8:15
http://www.mrmjournal.com/content/8/1/15
findings suggest that oxygen therapy during sleep
may be beneficial in patients with primary alveolar
hypoventilation and CSA leading to significant improvement of SDB and all related symptoms [12].
Oxygen administration during sleep has been associated
with reproducible reduction of AHI [Table 1] Type I
ACM, whether alone or in combination with syringomyelia, can cause a great number of progressive disorders such
as dysphagia, alveolar hypoventilation, inhalation pneumonia, and respiratory failure [13]. In our patient recurrent
aspirations with consequent inhalation pneumonia occurred. The most important mechanism of recurrent aspiration pneumonia was dysphagia [14]. The alterations
underlying dysphagia are stretch injury to the lower cranial nerves caused by caudal displacement of the medulla
or compression of the swallowing centres in the brainstem
[15]. Probably the pressure determined by the cerebellar
tonsils on the hypoglossal nuclei and other swallowing
centres located in the medulla is tough to be the leading
cause of the dysphagia [16]. Recurrent aspirations result in
several respiratory infections which may lead both to postinflammatory bronchiectasis and lung parenchymal damage, causing chronic respiratory failure (CRF) [17,18].
Respiratory failure as the early manifestation in type I
ACM is uncommon and, generally, is the result of
postoperative conditions [19]. Cylindrical bronchiectasis,
as documented in Figure 2, have become a source of
repeated infections with recurrent exacerbations of CRF,
chronic cough, intense dyspnoea and fever treated with
antibiotics and often requiring hospitalization [20]. Respiratory failure probably has been caused not only by
neuromuscular disorders affecting the diaphragm due to
compression of neural centers in the brainstem, but also
resulted from swallowing disturbances and dysphagia further complicated by recurrent aspiration pneumonia.
Conclusions
This case report suggests that a neurologic cause can
always be considered for recurrent aspiration pneumonia
and progressive dysphagia, even in absence of prominent
signs and symptoms. The high prevalence of sleep apnoea
syndrome in patients with neurological disorders indicates
that respiratory disturbances during sleep should be systematically screened even in ACM patients, in order to
prevent nocturnal respiratory failure and all the risks
associated with nocturnal intermittent hypoxia. In summary, central sleep apnoea can be the typical manifestation of ACM and may be a life-threatening condition.
The severity of CSA may explain the reported increased
incidence of death during sleep in ACM patients [11].
Using a low flow oxygen during sleep, even in hypercanic
patients, avoids mechanical ventilation that is often not
well tolerated. Oxygen administration allows to solve
CSA and all related cerebrovascular risks associated
Page 4 of 5
with nocturnal respiratory failure and sleep fragmentation, improving quality of life. Oxygen therapy can
generate potentially deprimental effects. The most
relevant of these is the worsening of hypercapnia, which is
mediated by mechanisms such as hypoventilation and
ventilation-perfusion redistribution. Particularly sleep itself
generates ventilatory alterations that include an increase
in airway resistance and decreased sensitivity of respiratory centers. Arterial blood gases samples should be periodically taken at awakening to assess pCO2 in order to
prevent hypoventilation from the oxygen therapy [21,22].
The availability of further clinical studies for the treatment
of CSA with low flow oxygen in hypercapnic patients is
desiderable to avoid serious and irreversible damage.
Consent
"Written informed consent was obtained from the patient
for publication of this Case report and any accompanying
images. A copy of the written consent is available for
review by the Editor-in-Chief of this journal."
Abbreviations
ACM: Arnold Chiari Malformation; AHI: Apnea/Hypopnea Index; CRF: Chronic
Respiratory Failure; CSA: Central Sleep Apnea; OSA: Obstructive Sleep Apnea;
SDB: Sleep Disordered Breathing.
Competing interests
All the author declare that they have no competing interest.
Authors’ contributions
RC conceived and drafted the manuscript and the study design. NC, LB and
ADM participated in the design of the study. GDM participated in the design
and coordination of the study and helped to draft the manuscript. All
authors read and approved the final manuscript.
Author details
1
Pneumology Unit Policlinico “G. Rodolico”, University of Catania, Via Santa
Sofia 78, 95123, Catania, Italy. 2Respiratory Diseases, Università di Catania,
Catania, Italy. 3School of specialization in Respiratory Dideases, University of
Catania, Catania, Italy.
Received: 13 December 2012 Accepted: 28 January 2013
Published: 22 February 2013
References
1. Zollty P, Sanders MH, Pollack IF: Chiari Malformation and sleep-disorder
breathing: a review of diagnostic management issues. Sleep 2000,
23(5):637–643.
2. Arnett B: Arnold-Chiari Malformation. Arch Neurol 2003.
3. Dauvilliers Y, Stal V, Abril B, Coubes P, Bobin S, Touchon J, Escourrou P,
Parker F, Bourgin P: Chiari malformation and sleep related breathing
disorders. J Neurol Neurosurg Psychiatry 2007, 78:1344–1348.
4. Doherty MJ, Spence DPS, Young C, Calverley PMA: Obstructive sleep
apnoea with Arnold-Chiari malformation. Thorax 1995, 50(6):690–691.
5. American Sleep Disorders Association: Practice parameters for the
indications for polysomnography and related procedures. Sleep 1997,
20(6):406–422.
6. McNicholas WT, Carter JL, Rutherford R, Zamel N, Phillipson EA: Beneficial
effect of oxygen in primary alveolar hypoventilation with central sleep
apnea. Am Rev Respir Dis 1982, 125:773–775.
7. Balk RA, Hiller FC, Lucas EA, Scrima L, Wilson FJ, Wooten V: Sleep Apnea
and the Arnold-Chiari malformation. Am Rev Respir Dis 1985, 132:929–930.
8. White DP: Pathogenesis of obstructive and central sleep apnea. Am J
Respir Crit Care Med 2005, 172:1363–1370.
Campisi et al. Multidisciplinary Respiratory Medicine 2013, 8:15
http://www.mrmjournal.com/content/8/1/15
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Page 5 of 5
Eckert DJ, Jordann AS, Merchia P, Malhotra A: Central sleep apnea
Pathophysiology and treatment. Chest 2007, 131:595–607.
Rabec C, Laurent G, Baudouin N, Merati M, Massin F, Foucher P, Brondel L,
Reybet-Degat O: Central sleep apnoea in Arnold-Chiari malformation:
evidence of pathophysiological heterogeneity. Eur Respir J 1998,
12:1482–1485.
De Backer WA: Central sleep apnoea, pathogenesis and treatment: an
overview and perspective. Eur Respir J 1995, 8:1372–1383.
Aurora NR, Chowduri S, Ramar K, Bista SR, Casey KR, Lamm CI, Kristo DA,
Mallea JM, Rowley JA, Zak RS, Tracy SL: The treatment of central sleep
apnea syndrome in adults: practice parameter with an evidence-based
literature review and meta-analyses. Sleep 2012, 35(1):17–40.
Alvarez D, Requena I, Arias M, Valdés L, Pereiso I, De la Torre R: Acute
respiratory failure as the first sign of Arnold-Chiari malformation
associated with syringomyelia. Eur Respir J 1995, 8:661–663.
Achiron A, Kuristzky A: Dysphagia as the sole manifestation of adult type I
Arnold-Chiari malformation. Neurology 1990, 40:186–187.
Gamez J, Santamarina E, Codina A: Dypshagia due to Chiari I
malformation mimicking ALS. J Neurol Neurosurg Psychiatry 2003,
74:549–550.
Ikusaka M, Iwata M, Sasaki S, et al: Progressive dysphagia due to adult
Chiari I malformation mimicking amyotrofic lateral sclerosis. J Neurol
Neurosurg Psychiatry 1996, 60:357–358.
Seddon PC, Khan Y: Respiratory problems in children with neurological
impairment. Arch Dis Child 2003, 88:75–78.
Nathadwarawala KM, Richards CAL, Lawrie B, Thomas GO, Wiles CM:
Recurrent aspiration due to Arnold-Chiari type I malformation. BMJ 1992,
304:29.
Gagnadoux F: Sleep-disordered breathing in patients with Chiari
malformation: improvement after surgery. Neurology 2006, 66:136–138.
Tsao TC, Juang YC, Chiang YC, Tsai YH, Lan RS, Lee CH: Pneumonia
preceding respiratory failure. A rare, easily misleading clinical
manifestation in adult Arnold-Chiari malformation. Chest 1991,
99:1294–1295.
Guell Rous MR: Long-term oxygen therapy: are we prescribing
appropriately? Int J Chron Obstruct Pulmon Dis 2008, 3(2):231–237.
Stradling JR: Hypercapnia during oxygen therapy in airways obstruction:
a reappraisal. Thorax 1986, 41:897–902.
doi:10.1186/2049-6958-8-15
Cite this article as: Campisi et al.: Type I Arnold-Chiari malformation
with bronchiectasis, respiratory failure, and sleep disordered breathing:
a case report. Multidisciplinary Respiratory Medicine 2013 8:15.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Congress report
RASSEGNA
Stress ossidativo e infiammazione nella BPCO.
Alternative terapeutiche dell’infiammazione cronica
Stefano Marinari§, Antonella Spacone, Fernando De Benedetto
Riassunto
La Broncopneumopatia cronica ostruttiva (BPCO), patologia cronica infiammatoria, riconosce, fra i meccanismi
determinanti, lo stress ossidativo, effetto dello sbilanciamento fra sostanze ossidanti prodotte da fumo e inquinamento e difese antiossidanti. I complessi meccanismi
di questo fenomeno coinvolgono inoltre cellule infiammatorie che partecipano al determinismo con una produzione endogena di fattori ossidanti.
Le conseguenze più importanti dello stress ossidativo
sono la perossidazione lipidica, l’ossidazione dei lipidi di
membrana, l’azione ossidante sulle proteine, con conseguente perdita della loro funzione e l’alterazione degli
acidi nucleici, con conseguenze irreversibili sui processi
di trascrizione, traduzione e replicazione del DNA.
In condizioni normali l’azione degli ossidanti, enzimatici
e non enzimatici, è controbilanciata dalla presenza di sostanze antiossidanti che però risultano insufficienti nei
pazienti con BPCO, per predisposizione genetica o per
inattivazione.
Da questo meccanismo consegue un’azione ossidante diretta e l’attivazione di meccanismi infiammatori che coinvolgono processi trascrizionali con conseguente amplificazione del danno.
Numerosi sono stati i tentativi di influenzare questa catena di eventi. Fra le molecole più studiate sono i composti tiolici con dimostrato effetto antiossidante: N-acetilcisteina (NAC), dotata di attività antiossidante diretta e
indiretta (fonte di glutatione), la carbocisteina (scavenger
di radicali liberi) e la erdosteina (contrasto di formazione
dei radicali liberi previa metabolizzazione).
Certamente più numerose sono le informazioni relative
all’attività antiossidante della NAC che, dopo dimostrazione di efficacia in vitro, ha mostrato una significativa
azione terapeutica con effetti, nei pazienti con BPCO, sia
sulla frequenza delle riacutizzazione bronchitiche che
sull’iperinsufflazione polmonare. L’azione della NAC,
maggiore nelle fasi più precoci di malattia, cresce con l’aumentare della dose e con la durata della terapia.
In conclusione, lo stress ossidativo partecipa in maniera
determinante all’innesco e all’amplificazione dei processi
infiammatori cronici della BPCO. Alcune molecole come
la NAC hanno dimostrato di poter influenzare questo
meccanismo. Un loro utilizzo, soprattutto nelle fasi precoci di malattia, può incidere significativamente sulla storia naturale della malattia.
Parole chiave
BPCO, N-acetilcisteina, Stress ossidativo
Introduzione
La broncopneumopatia cronica ostruttiva (BPCO) è unamalattia infiammatoria a carattere cronico. L’infiammazione può essere variamente localizzata (in prevalenza
bronchiale, bronchiolare o alveolare, ma anche extra-polmonare) e avere differente natura (tossica, infettiva, allergica ecc.) [1]. A livello extra-polmonare essa gioca un
ruolo fondamentale nella patogenesi della componente
sistemica della BPCO [2].
L’infiammazione presente nella BPCO è caratterizzata
da squilibrio del sistema proteasi/ antiproteasi, responsabile della distruzione del parenchima polmonare, e da aumento dello stress ossidativo [3,4].
La flogosi viene attivata dal fumo di sigaretta e/o dall’esposizione a sostanze tossiche ambientali o dall’insorgenza di infezioni dell’apparato respiratorio [5,6].
Infatti il polmone, attraverso lo scambio diretto di materiale gassoso (10.000-20.000 litri di aria al giorno), con
la sua superficie epiteliale di ampiezza assolutamente
unica, costituisce sede elettiva dell’attività di molecole os-
§
Corresponding author
Email addresses:
SM: [email protected]
AS: [email protected]
FDB: [email protected]
UOC di Pneumologia, Ospedale Clinicizzato SS Annunziata, Chieti, Italia
I
MRM
Rassegna
sidanti sia di produzione endogena (cellule epiteliali alveolari e bronchiali, cellule endoteliali, neutrofili, eosinofili, cellule macrofagiche) che di origine esogena (fumo di
sigaretta, inquinanti ambientali); tali agenti ossidanti sono
alla base dello stress ossidativo [7].
volte nelle catene di trasduzione intracellulare dei segnali
(recettori, chinasi e fosfatasi, fattori di trascrizione), sono
sensibili ad alterazioni anche lievi di tale equilibrio [15].
Alterazioni di minore entità hanno solitamente un significato fisiologico, di “modulazione”, mentre gli squilibri
maggiori finiscono facilmente per produrre disfunzioni,
danno cellulare, apoptosi o necrosi.
Se le difese antiossidanti della cellula non bastano a
tamponare l’azione pro-ossidante, essa può rimanere danneggiata a vari livelli: 1) sui fosfolipidi delle membrane,
fino alla distruzione delle stesse con perdita della compartimentazione e dei trasporti selettivi; 2) sugli acidi nucleici,
con accumulo di mutazioni e alterazioni dell’espressione
genica; 3) sulle proteine, dove l’ossidazione dei residui di
cisteina e di altri aminoacidi finisce per causare alterazioni
della struttura e perdita di funzione (enzimatica, di trasporto, recettoriale, ecc). [16,17].
Lo stress ossidativo consegue all’azione di varie sostanze chimiche, innanzitutto i radicali liberi dell’ossigeno
(ROS).
Lo stress ossidativo
Lo stress ossidativo rappresenta il comune denominatore
di molte patologie croniche che possono colpire il nostro
organismo [8,9]. Organi e processi fisiopatologici molto
distanti (esempio BPCO e malattie intestinali) in realtà
vedono coinvolti nella loro patogenesi stesse vie metaboliche ed elementi cellulari; il rimodellamento della cromatina (composta da DNA e istoni) è il meccanismo comune che regola l’espressione dei geni che codificano per
le proteine infiammatorie [10-12] (Tabella 1). Questo processo richiede la partecipazione di co-attivatori e di fattori
di trascrizione, indispensabili per la sintesi proteica delle
proteine infiammatorie [13,14], tra cui il fattore nucleare
kB (NF-kB) che, a seguito dell’esposizione cellulare a fattori infiammatori come l’interleuchina (IL)-1β e il fattore
di necrosi tumorale-alfa (TNF-α), provocano l’attivazione
di geni che codificano per proteine infiammatorie, fra cui
il fattore stimolante le colonie granulocito-macrofagiche
(GC-CSF).
Alla base dello stress ossidativo c’è uno sbilanciamento
tra sostanze ossidanti e antiossidanti (il cosiddetto equilibrio ossido riduttivo o equilibrio redox) [15].
Un corretto bilanciamento di questo equilibrio è essenziale per tutta una serie di funzioni fisiologiche all’interno dell’organismo, in quanto numerose proteine coin-
I radicali liberi dell’ossigeno e le specie radicaliche
dell’azoto (RNS)
I ROS sono molecole che posseggono un elettrone spaiato
sull’orbitale più esterno e questa configurazione li rende altamente instabili e particolarmente reattivi [15,18-19]. Essi,
reagendo facilmente con qualsiasi molecola si trovi in loro
prossimità (carboidrati, lipidi, proteine, acidi nucleici) la
danneggiano e spesso ne compromettono la funzione.
Fra i ROS c’è l’“anione superossido” che si forma quando
l’ossigeno molecolare è ridotto in presenza di un singolo
Tabella 1 Le principali patologie umane in cui è stato riconosciuto un ruolo delle reazioni di stress ossidativo
Processi infiammatori
Glomerulonefriti
Malattie autoimmuni
Artrite reumatoide
Patologie respiratorie
Effetti del fumo di sigaretta
Enfisema/BPCO
Fibrosi cistica
ARDS
Fibrosi polmonare
Patologie neurologiche
M. di Alzheimer
M. di Parkinson
Sclerosi multipla
Distrofie muscolari
Tossicità da alluminio
Patologie cardiovascolari
Infarto miocardico
Ictus
Aterosclerosi
Ipertensione arteriosa
Patologie ematologiche
Anemia falciforme
Favismo
Anemia di Fanconi
Patologie cutanee
Porfirie
Vitiligine
Psoriasi
Danno da radiazioni
Altre patologie
Diabete
Alcolismo
Pancreatite acuta
Effetti cronici della terapia dialitica
Tossicità da metalli pesanti
Invecchiamento
Tratto da [11] mod.
II
MRM
Rassegna
elettrone. Esso, in presenza dell’enzima superossidodismutasi (SOD) forma il perossido d’idrogeno (H2O2), anch’esso
composto molto tossico per le cellule: infatti incubando
cellule con H2O2 si verifica danno del DNA, distruzione di
membrana, rilascio di ioni Ca2+ dalle cellule e attivazione
di proteasi e nucleasi Ca-dipendenti [5].
L’anione superossido si può formare nel metabolismo
aerobio di tutte le cellule, potendo causare sia la co-ossidazione di composti chimici esogeni, sia un’azione tossica
diretta; inoltre macrofagi e altri fagociti producono anione
superossido durante la loro attivazione [5].
I ROS, reagendo con altre molecole, hanno la capacità
di auto propagarsi trasformando i loro bersagli in altri radicali liberi e scatenando così reazioni a catena che possono provocare estesi danni nella cellula.
In condizioni normali ciascuna cellula produce radicali
liberi tramite vari processi, come reazioni enzimatiche (ad
esempio la xantina ossidasi o la NO sintasi), fosforilazione
ossidativa e difesa immunitaria (granulociti neutrofili e
macrofagi) [19]. Queste piccole quantità sono tollerate e
vengono inattivate da sistemi enzimatici di difesa antiossidante, come il glutatione e altri antiossidanti detti scavenger per la loro capacità di neutralizzare i radicali liberi.
Accanto ai ROS esiste una famiglia di radicali liberi che
interessa l’azoto, cioè le specie radicaliche dell’azoto (RNS)
(es. ossido nitrico). L’ossido nitrico, in presenza di elevati
livelli di superossido e perossido di idrogeno, forma il perossinitrito che è un composto ad elevata tossicità.
La sovrapproduzione di ROS/RNS causa stress ossidativo, o nitrosativo, al quale consegue l’alterazione delle
strutture cellulari, incluse le membrane, i lipidi, le proteine
e il DNA [20].
I principali meccanismi innescati da queste specie reattive sono di seguito riportati: la lipoperossidazione, l’ossidazione delle proteine e i danni degli acidi nucleici.
come le aldeidi e i chetoni. Quando si formano, in situ, le
aldeidi possono reagire con i costituenti delle membrane.
L’emivita delle aldeidi è maggiore di quella dei radicali, e
conseguentemente esse possono diffondere a grande distanza e attaccare strutture che non sono in vicinanza del
sito di origine dei prodotti dei radicali liberi, agendo da
amplificatori del danno. Rappresentanti importanti di
questo gruppo sono la malondialdeide (MDA) e le aldeidi
insature [12].
È stato osservato che i livelli di MDA nel tessuto polmonare sono inversamente correlati con il tempo trascorso dall’ultima sigaretta fumata e sono associati a un
maggior grado di ostruzione delle piccole vie aeree nei
pazienti con BPCO. Elevati livelli di perossidazione lipidica sono stati riscontrati nel siero dei pazienti con BPCO
stabile [22-24].
Ossidazione delle proteine
Per quanto riguarda le proteine, le reazioni ossidative provocate dai radicali liberi hanno come conseguenza la proteolisi o la loro aggregazione aberrante. È stato dimostrato su proteine purificate che l’azione dei ROS altera
completamente le proprietà chimico-fisiche caratteristiche della proteina stessa, quali una variazione del punto
isoelettrico (causata da ossidazioni dei gruppi -R degli
amminoacidi mediante carbonilazione) e un’alterazione
del peso molecolare dovuta alla formazione di legami intramolecolari o alla scissione della proteina in frammenti
peptidici [12]. Questi cambiamenti provocano l’attivazione di specifici enzimi proteolitici e conseguente degradazione della proteina.
La carbonilazione, laddove avvenga in maniera lieve e
progressiva, è associata alla perdita irreversibile della funzione della proteina che viene eliminata dal proteasoma
e dunque permette la sopravvivenza cellulare. L’eccessiva
ossidazione e il conseguente cross-linking rende, invece,
le proteine resistenti alla degradazione proteolitica e determina l’insorgenza della morte cellulare [12].
Per ciò che riguarda gli acidi nucleici, è stato dimostrato
già da vari anni che le alterazioni ossidative inibiscono irreversibilmente i processi di trascrizione, traduzione e replicazione del DNA portando alla prematura senescenza
e alla morte cellulare [25].
Infine il “fumo di sigaretta” può indurre direttamente
rottura della singola elica del DNA in cellule umane [25].
La perossidazione lipidica
La lipoperossidazione (LPO) è probabilmente il processo
più studiato indotto dai radicali liberi. Infatti, i ROS sono
in grado di generare – attraverso un processo di perossidazione lipidica – l’ossidazione dei fosfolipidi di membrana, con conseguente attivazione di una reazione a catena che si automantiene e favorisce altresì la genesi di
mediatori pro-flogogeni e chemiotattici attraverso l’attivazione dei leucociti, dei mastociti e dei macrofagi [21].
L’abbondante presenza di membrane nei siti dove si
formano i radicali e i ROS le rende un facile bersaglio da
parte dei radicali liberi.
Dalla degradazione dei lipoperossidi origina una quantità notevole di dieni coniugati e metaboliti carbonilici,
Origine degli ossidanti
I principali agenti ossidanti per il polmone possono essere
di “origine esogena” come il fumo di sigaretta [26], l’inquinamento ambientale (per esempio ozono, biossido di
III
MRM
Rassegna
OSSIDANTI
ANTIOSSIDANTI
• Fumo di sigaretta
gas (olefine, dieni, NO)
catrame (semichinoni)
• Sistemi enzimatici
catalasi, SOD
GSH perossidasi, GSH reduttasi
• Inquinamento atmosferico
ozono
NO2
particolato
• Composti lipo-solubili
vitamina E, β-carotene
• Metabolismo Cell
(PMN, AM, Eos)
O2– ., H2O2, .OH
MPO, XO
• Fagocitosi
DNA, che sono tipiche della broncopneumopatia cronica
ostruttiva e della sua evoluzione [28].
L’ossidazione ha però anche un’origine prettamente endogena e i mitocondri sono considerati il maggior sito di
produzione di ROS endogeni. In particolare, durante la
fosforilazione ossidativa una quota di elettroni sfugge dai
complessi proteici e interagisce con l’ossigeno generando
radicale superossido [29].
• Composti idro-solubili
vitamina C, acido urico
GSH
cisteina, taurina
Le difese antiossidanti
In condizioni normali l’azione degli ossidanti è controbilanciata dalla presenza di “agenti antiossidanti” che possono essere distinti in non enzimatici ed enzimatici [30,31].
Tra i primi ci sono acido ascorbico (Vit C), alfa-tocoferolo (Vit E) e acido urico, contenuti anche nel liquido
di rivestimento epiteliale che protegge il polmone da insulti esterni. Molecole più grandi, come albumina e mucina, possono fungere come antiossidanti esponendo dei
gruppi sulfidrilici. Il Coenzima Q svolge la sua azione antiossidante a livello della catena mitocondriale del trasporto degli elettroni. Diversi studi dimostrano una correlazione fra riduzione di queste sostanze e alterazione
della funzione polmonare [32].
Esistono poi sistemi antiossidanti di tipo enzimatico,
altamente efficienti, come quelli rappresentati da glutationeperossidasi (GSH-Px), superossidodismutasi (SOD)
ecatalasi, presenti anche a livello polmonare [3].
• Antiossidanti ad alto PM
albumina
ceruloplasmina
Tratto da [27] mod.
Figura 1 Principali agenti ossidanti e antiossidanti a livello polmonare.
azoto, particolato aereo), oppure derivare da “meccanismi
endogeni” attraverso il metabolismo di diverse cellule infiammatorie come i leucociti polimorfonucleati neutrofili
ed eosinofili, i macrofagi alveolari e i processi di fagocitosi.
Nel tessuto polmonare a questi agenti ossidanti si oppone un sistema ad azione antiossidante costituito da vari
enzimi, composti liposolubili, composti idrosolubili e sostanze ad alto peso molecolare (Figura 1) [27].
Uno degli ossidanti esogeni più importanti è il “fumo
di sigaretta” il quale è una miscela complessa di entità chimiche diverse con capacità ossidanti, sia dirette sia indirette. I ROS contenuti nel fumo di sigaretta inducono una
“reazione a catena”, avente come substrato iniziale le membrane cellulari che sono oggetto di perossidazione lipidica
che, attraverso fasi successive, porta all’evento fondamentale rappresentato dalla slatentizzazione di stress-chinasi
(c-Junactivatedkinase, extracellularsignal-regulatedkinase,
p38) e fattori di trascrizione redox-sensitivi come il nuclearfactorkB (NF-kB) e l’activator protein-1 (AP-1), che saranno promotori di una serie di alterazioni a carico della
struttura proteica di sostegno del DNA (istone). L’istone
così “denaturato” sarà a sua volta sede di sintesi di molecole quali: citochine, chemochine, fattori di crescita, molecole di adesione, immunorecettori, mediatore dell’infiammazione e protoncogeni [24,25].
Il processo flogistico così innescato rappresenterà una
fonte costante di radicali liberi (con impossibilità da parte
dei sistemi di difesa antiossidante di bilanciare adeguatamente questa cascata) che danno origine a tutta una serie
di alterazioni cellulari da essi mediate, rappresentate da
broncostruzione, rimodellamento extracellulare e proliferazione, ipersecrezione mucosa, inattivazione delle antiproteasi, disfunzione muscolare, apoptosi, danno del
Stress ossidativo e BPCO
Lo stress ossidativo induce una serie di danni a livello polmonare (Tabella 2) [12].
Nella BPCO è chiaro che la fonte principale di ossidanti
Tabella 2 Danni polmonari indotti dallo stress ossidativo
Vie aeree
Contrazione cellule muscolari lisce
Alterazione funzionale β-recettori
↑ secrezione bronchiale
Attivazione dei mastociti
Alveoli
↑ permeabilità
↑ lisi cellulare
Matrice polmonare
↓ sintesi di elastina e frammentazione
↓ sintesi collagene e frammentazione
Depolimerizzazione dei proteoglicani
Antiproteasi
Inattivazione inibitore α1-antitripsina
Inattivazione inibit. della secrez. leucoproteasi
Circolo polmonare
Alterazione delle cellule muscolari vascolari
↑ Permeabilità microcircolo
Sequestro dei neutrofili
Adesione dei neutrofili all’endotelio
Fattori di trascrizione
Attivazione dei geni codificanti per TNF-α, IL-8
e altre proteine pro infiammatorie
Tratto da [12] mod.
IV
MRM
Rassegna
è il fumo di sigaretta, oltre agli abituali agenti inquinanti
presenti soprattutto nella grandi città come conseguenza
della produzione industriale, del traffico veicolare e dei sistemi di riscaldamento urbano assieme alle particolari
condizioni climatiche. Ciò è stato confermato da diverse
evidenze relative alla presenza di perossido di idrogeno e
altri markers di stress nel condensato espirato (EBC) di
pazienti affetti da BPCO [33,34]. Anche studi di biologia
molecolare hanno messo in evidenza il ruolo primario in
tal senso svolto dai radicali liberi contenuti nel fumo di sigaretta. Inoltre nella BPCO vi è una aumentata produzione endogena di ROS legata all’attività mitocrondriale,
alla fagocitosi, normalmente controbilanciate dai meccanismi antiossidanti di origine enzimatica e non [21].
Gli agenti ossidanti, innanzitutto il fumo di sigaretta,
agiscono dunque in senso proinfiammatorio e a livello
molecolare l’azione si esplica attraverso proteine ad attività
chinasica in grado di attivare alcuni fattori di trascrizione
(come il sistema AP-1 e NF-kB), a loro volta responsabili
della trascrizione di altri geni coinvolti nella regolazione
della risposta infiammatoria, come citochine (per esempio
interleuchina-8, TNF-α) o molecole di adesione (per
esempio β-integrine) [3,27] (Figura 2).
Almeno 50 diverse citochine e chemokine sono state
associate alla BPCO e l’NF-kB, innescato anche dal fumo
di sigaretta, in questa malattia risulta molto attivo e correlato con l’ostruzione bronchiale [21].
Le cellule infiammatorie, richiamate nei siti dalle citochine attivate, rilasciano a loro volta una varietà di mediatori che interagiscono in maniera complessa con i
componenti cellulari e tissutali. Neutrofili, eosinofili e
macrofagi alveolari generano dopo attivazione altri me-
taboliti dell’ossigeno, che a loro volta stimolano altre cellule infiammatorie con un meccanismo di feed back positivo [36]. E così il processo di stress ossidativo e infiammazione si automantiene.
Anche le infezioni (batteriche, virali, tossiche, ecc),
presenti durante le riacutizzazioni di BPCO, contribuiscono allo stress ossidativo reclutando e/o attivando cellule fagocitarie, portando alla produzione da parte di queste cellule di sostanze ossidanti o molecole che a loro volta
mantengono l’infiammazione [14,30].
In pazienti con BPCO è stata dimostrata una “riduzione della capacità antiossidante totale; in soggetti fumatori il potenziale antiossidante è ridotto”: per esempio,
nei globuli rossi di questi soggetti è stata osservata una
riduzione dell’attività di alcuni enzimi come la glucosio6-fosfato deidrogenasi e la glucosio-fosfatasi, che porta a
una maggiore suscettibilità e alla lipoperossidazione rispetto ai globuli rossi di soggetti non fumatori [35].
Infine nella BPCO sono state dimostrate, sia una riduzione del sistema enzimatico GSH dipendente, che una
maggiore espressione del TGF-Beta, in grado di inibire
l’attivazione di catalasi e SOD nelle cellule muscolari lisce
bronchiali. Entrambi i sistemi antiossidanti, importanti
per neutralizzare i ROS mitocondriali, sono sotto il controllo del fattore trascrizionale FOXO3 (la cui attività è
stata evidenziata ridotta nella BPCO) [25].
Gli stessi meccanismi e mediatori dell’infiammazione
presenti a livello polmonare possono causare la flogosi sistemica, con disfunzione del muscolo scheletrico fino alla
cachessia [36], il cui principale responsabile è lo stress ossidativo.
Implicazioni terapeutiche
Fino ad oggi nessuna terapia ha dimostrato di poter incidere significativamente sull’infiammazione cronica della
BPCO e sulla sua progressione. La terapia steroidea inalatoria, efficace nell’infiammazione che è alla base dell’asma bronchiale, dimostra nella BPCO solo un’attività
significativa nel ridurre le riacutizzazioni. Una spiegazione potrebbe coinvolgere lo stress ossidativo; infatti, secondo una suggestiva teoria di Barnes, un meccanismo
correlato all’azione dello stress carbonilico sull’HDAC2,
in parte reversibile con l’utilizzo di basse dosi di teofillina,
potrebbe essere la causa di tale inefficacia [37].
Viene di seguito proposta un’analisi dei risultati degli
studi sulle possibilità di influenzare farmacologicamente
lo stress ossidativo e di conseguenza la sua influenza sull’infiammazione cronica nella BPCO.
Trattandosi di infiammazione neutrofilica, un bersaglio
interessante potrebbe essere la riduzione del sequestro
Tratto da [27] mod.
Figura 2 Rappresentazione dello stress ossidativo nella
BPCO.
V
MRM
Rassegna
Attuali possibilità terapeutiche
Le molecole con potenzialità terapeutiche antiossidanti
attualmente disponibili provengono dal gruppo dei composti tiolici o analoghi ad azione antiossidante diretta (detossificante, scavenger) e indiretta, mediante il controllo
dell’attivazione dell’NF-kB e dell’espressione genetica di
geni pro-infiammatori.
Fra queste molecole è la carbocisteina, ad attività mucolitica ma con gruppo tiolico bloccato e con attività antiossidante legata quindi ad attività scavenger indiretta.
Studi finora condotti hanno mostrato una sua azione sulla
riduzione del numero di riacutizzazioni bronchitiche nella
BPCO. In particolare lo studio PEACE, indagine multicentrica cinese, randomizzata, controllata vs placebo, su 709
pazienti con BPCO (qualsiasi gravità) trattati con carbocisteina 1500 mg/die per 1 anno, ha mostrato una significativa riduzione delle riacutizzazioni nel gruppo trattato [45].
Molecola fondamentale nel meccanismo antiossidante
è il glutatione (GSH). Purtroppo la somministrazione sistemica di questa sostanza non ha dimostrato un significativo trasporto intracellulare [46] e una somministrazione aerosolica indurrebbe un aumento dell’iperreattività
bronchiale [47]. È quindi necessario aumentare la sua produzione endogena per la quale è determinante la disponibilità di cisteina anch’essa non somministrabile dall’esterno perché può produrre effetti neurotossici [48].
L’Erdosteina è un farmaco mucolitico con attività antinfiammatoria e antiossidante. Il meccanismo antiossidante è determinato dall’azione di contrasto sulla formazione di radicali liberi, tuttavia, non possedendo gruppi
tiolici liberi, deve essere attivato previa metabolizzazione.
Il metabolismo dell’erdosteina non porta comunque alla
formazione di cisteina.
Principale studio clinico su questa molecola è quello
di Moretti e coll. [49], trial multicentrico italiano, randomizzato, controllato vs placebo, condotto in 155 pazienti
con BPCO moderata trattati con erdosteina 300 mg due
volte al dì per 8 mesi, nei quali è stata dimostrata una significativa riduzione del numero di riacutizzazioni e di
ospedalizzazioni e una migliore qualità della vita.
Fonte di L-cisteina è invece l’N-acetilcisteina che, attraverso questa molecola, consente di aumentare la produzione di glutatione, determinante nell’azione antiossidante. Essa ha inoltre una azione antiossidante diretta
attraverso il gruppo tiolico libero.
H2S, acido solfidrico; MPO,mieloperossidasi; NAC, N-acetilcisteina;
NAL, N-acistelina; NOX, NADPH ossidasi; Nrf2, nuclear-erythroid-2-related factor;
SOD, superossidodismutasi.
Tratto da [40] mod.
Figura 3 Possibili differenti approcci terapeutici per
neutralizzare lo stress ossidativo nella BPCO. Tioli, scavengers di ossidanti e perossidasi mimetici neutralizzano
direttamente lo stress ossidativo. SOD mimetici e attivatori
di Nrf2 cercano di compensare la riduzione dell’attività di
queste sostanze dimostrata nella BPCO. Inibitori di NOX e
MPO bloccano l’aumentato stress ossidativo indotto da
questi sistemi enzimatici.
polmonare di neutrofili, i quali, una volta sequestrati a livello polmonare, perpetuano la loro azione ossidante
anche in relazione alla ridotta deformabilità indotta dal
fumo, che ne condiziona la motilità intracapillare. In questo senso sono promettenti gli studi sulla N-acetilcisteina
(NAC) che ha dimostrato, in vitro, di ripristinare la deformabilità neutrofilica [38] e sul cilomilast, inibitore della
fosfodiesterasi 4, il quale, incrementando la produzione di
AMP ciclico, porta a una stabilizzazione dei neutrofili e a
una riduzione del rilascio di sostanze ossidanti [39].
Numerosi sono i tentativi di sviluppare molecole in
grado di ridurre l’ossidazione o di aumentare le difese antiossidanti (Figura 3).
Interessanti risultati sono stati ottenuti con attivatori del
Nrf2, alcuni dei quali (BG-12) hanno dimostrato una
buona azione antiossidante con scarsi effetti collaterali
nella terapia della sclerosi multipla e che saranno probabilmente a breve registrati per questo utilizzo [41,42]. Altri
risultati promettenti vengono dallo studio dei SOD mimetici (AEOL10113), inibitori di NOX come il celestrolo [43]
e inibitori di MPO come la 2-tioxantina e la ADZ5904 [44].
Tentativi di ripristinare la biodisponibilità di antiossidanti a livello polmonare attraverso la somministrazione
di sostanze, come vitamina C ed E, con la dieta non hanno
dimostrato risultati soddisfacenti [32].
N-Acetilcisteina (NAC): passate e recenti evidenze
di una azione antiossidante
Le prime evidenze sperimentali di questa molecola risalgono al 1986 con gli studi in vitro di Moldeus e coll. [50].
VI
MRM
Rassegna
L’aggiunta di NAC riduceva in vitro la liberazione di perossido di idrogeno e LDH e limitava la riduzione di GSH
correlata allo stress ossidativo, dimostrando così una attività GSH-agonista.
Nascono successivamente evidenze di studi in vivo. Una
delle prime è da parte di Bridgeman e coll. [51] che studiano l’azione in vivo, in acuto della NAC. La NAC somministrata in una singola dose giornaliera di 600 mg/die
per 5 giorni è in grado di aumentare le concentrazioni di
glutatione ridotto nel plasma e, in particolar modo, a livello del fluido di lavaggio broncoalveolare (BAL).
Alla luce di queste evidenze in acuto venivano condotti
trials con somministrazioni più prolungate. Uno degli studi
più significativi e quello di Kasielski e Nowak [52] condotto
per determinare se NAC (600 mg per 12 mesi) fosse in
grado di ridurre, in pazienti BPCO (lieve-moderata, terapia
steroidea sospesa da 3 mesi), la quantità di H2O2 e di TBARs
e di prodotti di perossidazione lipidica. Alla fine dei 12 mesi
il gruppo NAC esalava H2O2 2,7 volte in meno rispetto al
gruppo placebo, mentre non erano osservate differenze nei
due gruppi in merito alla quantità di TBAR nell’aria esalata
o ai livelli di prodotti di perossidazione lipidica nel plasma.
Qualche anno più tardi De Benedetto e coll. pubblicavano uno studio con caratteristiche originali [53]: una
nuova tecnica di dosaggio del perossido di idrogeno nel
condensato dell’aria espirata e l’utilizzo di un dosaggio di
NAC superiore (600 mg B.I.D.). I pazienti studiati erano
pazienti con BPCO lieve-moderata che non assumevano
steroidi da almeno 2 mesi. Nel gruppo dei pazienti trattati
per 2 mesi si rilevava un livello di perossido di idrogeno
nel condensato espirato significativamente inferiore rispetto al gruppo di controllo nel quale veniva documentato invece un progressivo aumento.
Tutti questi risultati sono il presupposto per il primo
ampio studio multicentrico europeo sull’effetto del trattamento a lungo termine (3 anni) della NAC nella BPCO:
lo studio BRONCUS [54]. Gli outcome scelti per lo studio
erano il declino funzionale e la frequenza annuale di riacutizzazioni. In 523 pazienti con BPCO (stadi II e III
GOLD- 70% dei pazienti assumevano steroidi) randomizzati per ricevere NAC 600 mg/die vs placebo per 3 anni,
non si evidenziavano risultati significativi riguardo al declino funzionale né al numero di riacutizzazioni. Il fallimento dello studio induceva però gli sperimentatori ad
una riflessione relativa alla scelta del campione studiato
e agli outcome scelti. Un’analisi del sottogruppo di pazienti non in terapia steroidea inalatoria evidenziava infatti una significativa riduzione delle riacutizzazioni e una
valutazione dei volumi polmonari dimostrava una significativa riduzione dell’iperinsufflazione(370 ml).
L’effetto sulla riduzione delle riacutizzazioni viene confermato da una metanalisi [55] condotta nel 2005 su tutti
gli studi pubblicati a quel tempo sulla NAC nella BPCO,
dato rafforzato dall’esclusione dalla metanalisi dello studio BRONCUS.
Per quanto riguarda invece l’azione sulla iperinflazione,
dati interessanti possono essere dedotti dallo studio successivo di Stav e coll. [56]. Gli Autori evidenziavano come
il trattamento di pazienti con BPCO moderata-grave con
NAC a dosaggio di 600 mg B.I.D., anche in associazione a
steroidi inalatori, per periodi prolungati (6 mesi), fosse in
grado di influenzare la capacità vitale forzata, la capacità
inspiratoria dopo sforzo e il tempo di endurance, dimostrando l’effetto del trattamento sull’iperinflazione statica
e dinamica di questi pazienti. Tali risultati funzionali sono
confermati da uno studio recente [57] nel quale il trattamento con NAC 600 mg B.I.D. per un anno in BPCO stabili influenzava significativamente i valori di FEF25-75 e la
reattanza, misurata con il metodo delle oscillazioni forzate
(FOT), e determinava una riduzione significativa delle riacutizzazioni bronchitiche.
Infine è di recente pubblicazione il più ampio studio
sull’efficacia di NAC sulle riacutizzazioni di BPCO: lo studio PANTHEON [58]. Si tratta di uno studio multicentrico,
prospettico, stratificato, randomizzato, in doppio cieco,
controllato verso placebo, a gruppi paralleli su 1.006 pazienti, di età compresa tra 40 ed 80 anni, con storia di almeno 2 riacutizzazioni nei 2 anni precedenti e con BPCO
stabile GOLD II e III (VEMS media: 49%). I pazienti sono
stati trattati con NAC 600 mg, due volte al giorno per 1
anno, in associazione a terapia standard in accordo con il
livello di gravità GOLD (quindi in prevalenza in associazione con steroidi inalatori). I risultati dimostrano in maniera molto efficace che una terapia con NAC a dosaggio
aumentato è in grado di ridurre significativamente la frequenza di riacutizzazioni, soprattutto nel gruppo di BPCO
di grado moderato (39% di riduzione) (Figura 4).
Inoltre un’analisi dei dati nel tempo mostra chiaramente come l’effetto sia evidente già dopo sei mesi di trattamento e come sia progressivo nel tempo (Figura 5).
Conclusioni
Lo stress ossidativo gioca un ruolo determinante nella patogenesi della BPCO. Complessi meccanismi biochimici
collegano lo stress ossidativo all’infiammazione e partecipano alla sua amplificazione e cronicizzazione attraverso azioni dirette e indirette sulla trascrizione genica.
Gli studi finora condotti dimostrano interessanti risultati relativamente alla possibilità di influenzare tale meccanismo. Molti di essi sono stati condotti in particolare
VII
MRM
Rassegna
Tratto da [58] mod.
Figura 4 Effetti di NAC nel campione di pazienti in studio. Frequenza e rischio di riacutizzazione nei pazienti trattati
con NAC 600 mg B.I.D e Placebo nel campione totale e nel gruppo di pazienti con BPCO moderata.
contemporanea terapia steroidea inalatoria), aumenta con
la durata della terapia. Il suo utilizzo regolare e a dosaggio
di 600 mg B.I.D., soprattutto nella BPCO in fase precoce
di malattia, può incidere significativamente sulla storia
naturale della malattia e la qualità della vita.
Conflitto di interessi
Gli Autori dichiarano di non avere alcun conflitto di interessi.
Ricevuto: 19 maggio 2014
Accettato: 3 giugno 2014
Pubblicato: settembre 2014
Tratto da [58] mod.
Figura 5 Effetto progressivo del trattamento con NAC 600
mg B.I.D. sulla frequenza delle riacutizzazioni di BPCO.
sui composti tiolici (N-acetilcisteina, carbocisteina, erdosteina, fudosteina).
Fra le molecole attualmente disponibili e senz’altro con
maggiori prove sperimentali, l’N-acetilcisteina, per la sua
azione diretta e indiretta, ha dimostrato di possedere significativa attività antiossidante in pazienti con BPCO.
Studi clinici mostrano una sua efficacia nella riduzione
dell’iperinflazione e delle riacutizzazioni bronchitiche a
fronte di una ottima tollerabilità. Studi recenti (studio
PANTHEON) dimostrano inoltre che la sua attività, maggiore nelle fasi più precoci di malattia e influenzata dalla
dose (bassi dosaggi non sembrano efficaci in pazienti in
Bibliografia
1. Agusti AG: COPD, a multicomponent disease: implications for management. Respir Med 2005, 99(6):670–682.
2. Wouters EF: Local and systemic inflammation in chronic obstructive pulmonary disease. Proc Am Thorac Soc 2005; 2(1): 26–33.
3. Rahman I, Adcock IM: Oxidative stress and redox regulation of lung inflammation in COPD. Eur Resp J.2006,28(1):219–242.
4. Barnes PJ: Chronic obstructive pulmonary disease. N Engl J Med 2000,
343(4):269–280.
5. Saetta M, Turato G, Facchini FM, Corbino L, Lucchini RE, Casoni G, Maestrelli P, Mapp
CE, Ciaccia A, Fabbri LM: Inflammatory cells in the bronchial glands of smokers with chronic bronchitis. Am J Respir Crit Care Med 1997, 156(5):1633–1639.
6. Rutgers SR, Postma DS, ten Hacken NH,Kauffman HF, van Der Mark TW, Koёter GH,
Timens W: Ongoing airway inflammation in patients with COPD who do
not currently smoke. Chest 2000, 55(1):12–18.
7. Rahman I, MacNee W: Role of oxidants/antioxidants in smoking induced
lung diseases. Free Radic Biol Med 1996, 21(5):669–681.
8. Warren JS, Johnson KJ, Ward PA: Consequences of oxidant injury. In The lung:
scientific foundations.2nd edition. Edited by Crystal R, Gand J, WestB. New York:
Raven Press; 1999:2279–2288.
9. Davies KJ, Quintanilha AT, Brooks GA, Packer L: Free radicals and tissue damage
produced byexercise. Biochem Biophys Res Commun 1982, 107(4):1198–1205.
10. Harman D: The aging process. Proc Natl Acad Sci U S A 1981, 78(11):7124–7128.
VIII
MRM
Rassegna
11. Corti A, De Tata V, Pompella A: Agenti e meccanismi di stress ossidativo nella
patologia umana. Ligand Assay 2009, 14(1):8–15.
12. Braghiroli A: Le peculiarità dell’infiammazione nella BPCO: la sfida terapeutica di un processo ad oggi ancora reversibile. Multidiscip Resp Med 2007;
3:32–46.
13. Barnes PJ: How corticosteroids control inflammation: Quintiles Prize Lecture 2005. Br J Pharmacol 2006, 148(3):245–254.
14. Barnes PJ: Reduced histone deacetylase in COPD; clinical implication. Chest
2006, 129(1):151–155.
15. Gutteridge JM, Halliwell B: Free radicals and antioxidants in the year 2000.
A historical look to the future. Ann NY Acad Sci 2000; 899:136–147.
16. Schraufstätter I, Hyslop PA, Jackson JH, Cochrane CG: Oxidant-induced DNA
damage of target cells. J Clin Invest 1988, 82(3):1040–1050.
17. Jackson JH, Schraufstätter IU, Hyslop PA, Vosbeck K, Sauerheber R, Weitzman SA,
Cochrane CG: Role of oxidants in DNA damage. Hydroxyl radical mediates
the synergistic DNA damaging effects of asbestos and cigarette smoke.
J Clin Invest 1987, 80(4):1090–1095.
18. Halliwell B, Gutteridge J: Free Radicals in Biology and Medicine. Oxford, UK: Oxford
Univ. Press; 2002:936.
19. Halliwell B, Gutteridge, JMC: Antioxidant defenses; in Free Radicals. In Biology
and Medicine. Oxford: Clarendon Press; 1989:105–244.
20. Repine JE, Bast A, Lankhorst I, and The Oxidative Stress Study Group: Oxidative
stress in COPD. Am J Respir Crit Care Med 1997: 156:341–357.
21. Rahman I, MacNee W: Role of transcription factors in inflammatory lung disease. Thorax 1998; 53:601–612.
22. Paredi P, Kharitonov SA, Leak D, Ward S, Cramer D, Barnes J: Exhaled ethane, a
marker of lipid peroxidation, is elevated in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2000; 162:369–373.
23. Hamilton RF Jr, Li L, Eschenbacher WL, Szweda L, Holian A: Potential involvement of 4-hydroxynonenal in the response of human lung cells to ozone.
Am J Physiol 1998; 274:L8–L16.
24. Petruzzelli S, Hietanen E,Bartsch H, Camus AM, Mussi A, Angeletti CA, Saracci R,
Giuntini C: Pulmonary lipid peroxidation in cigarette smokers and lung
cancer patients. Chest 1990; 98:930–935.
25. Nakayama T, Kaneko M, Kodama M, Nagata C: Cigarette smoke induces DNA
single-strand breaks in human cells. Nature 1985; 314:462–464.
26. Schalberg T, Klein U, Rau M, Eller J, Lode H: Subpopulations of alveolar
macrophages in smokersand nonsmokers; relation to the expression of
CD11/CD18 molecules and superoxide anion production. Am J Respir Crit
Care Med 1995; 151(5):1551–1558.
27. Di Maria GU, Olivieri D, Vignola M, Bertorelli G, Petruzzelli S: Eziopatogenesi della
BPCO. In I Quaderni della BPCO. Il volto della BPCO che cambia. Edited by Giuntini
G, Grassi V. Torino: UTET Periodici; 2001, 1:81–115.
28. Bast A, Haenen GR, Doelman CJ: Oxidants antioxidants: state of the art. Am J
Med 1991, 91(3C):2S–13S.
29 van der Toorn M, Rezayat D, Kauffman HF, Bakker SJ, Gans RO, Koёter GH, Choi AM,
van Oosterhout AJ, Slebos DJ: Lipid-soluble components in cigarette smoke
induce mitochondrial productionof reactive oxygen species in lung epithelial cells. Am J Physiol Lung Cell Mol Physiol 2009, 297(1)L109–114.
30. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J: Free radicals and
antioxidants in normal physiological functions and human disease. Int J
Biochem Cell Biol 2007; 39(1):44–84.
31. Repine JE, Heffner JE: Lung Antioxidants: In The Lung: Scientific Foundations. Edited byCrystal RG,West JB, Weibel ER, Barnes PJ. Philadelphia: Lippincott-Raven,
1997:2259–2269.
32. de Batlle J, Barreiro E, Ramieu I, Mendez M, Gomez FB, Ferrer J, Orozco-Levi M, Gea
J, Antò JM, Garcia-Aymerich J: Dietary modulation of oxidative stress in chronic
obstructive pulmonary disease patients. Free Radic Res 2010, 44(1):1296–1303.
33. Dekhuijzen PN, Aben KKH, Dekker I, Aarts LP, Wielders PL, van Herwaarden CL, Bast
A: Increased exhalation of hydrogen peroxide in patients with stable and
unstable COPD. Am J Respir Crit Care Med 1996, 154(3Pt 1):813–816.
24. De Benedetto F,Aceto A, Dragani B, Spacone A, Formisano S, Cocco R, Sanguinetti
CM: Validation of a new technique to assess exhaled hydrogen peroxide: results from normals and COPD patients. Mon Arch Chest Dis2000; 55(3):185–188.
35. Wurzel H, Yeh CC, Gairola C, Chow CK: Oxidative damage and antioxidant status in the lungs and bronchoalveolar lavage fluid of rats exposed chronically to cigarette smoke. J Biochem Toxicol 1995, 10(1):11–17.
36. Wouters EF, Creutzberg EC, Schols AM: Systemic effects in COPD. Chest 2002,
121(5 Suppl):127S–130S.
37. Ford PA, Durham AL, Russell RE, Gordon F, Adcock IM, Barnes PJ: Treatment ef-
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
IX
MRM
fects of low-dose theophylline combined with an inhaled corticosteroid
in COPD. Chest 2010, 137(6):1338–1344.
Drost EM, Selby C, Lannan S, Lowe GD, MacNee W: Changes in neutrophil deformability following in vitro smoke exposure: mechanism and protection. Am J Respir Cell Mol Biol 1992, 6(3):287–295.
Drost E, Ouziaux L, Donaldson K, MacNee W: Cilomilast, a second generation
phosphodiesterase 4 inhibitor, in combination with PGE2 attenuates
fMLP, IL-8 and cigarette smoke-induced effects on the mechanical and
functional properties of neutrophils. Eur Respir J 2001, 18(Suppl.33):161S.
Kirkham PA, Barnes PJ: Oxidative stress in COPD. Chest 2013; 144(1):266–273.
Ichikawa T, Li J, Meyer CJ, Janicki JS, Hannink M, Cui T: Dihydro-CDDO-trifluoroethyl amide (dh404), a novel Nrf2activator, suppresses oxidative stress
in cardiomyocytes. PLoS One2009, 4(12):e8391.
Pareek TK, Belkadi A, Kesavapany S, Zaremba A, Loh SL, Bai L, Cohen ML, Meyer C,
Liby KT, Miller RH, Sporn MB, Letterio JJ: Triterpenoid modulation of IL-17 and
Nrf-2 expression ameliorates neuroinflammation and promotes remyelination in autoimmune encephalomyelitis. Sci Rep 2011,1:201.
Jaquet V, Marcoux J, Forest E, Leidal KG, McCormick S, Westermaier Y, Perozzo R,
Plastre O, Fioraso-Cartier L, Diebold B, Scapozza L, Nauseef WM, Fieschi F, Krause
KH, Bedard K: NADPH oxidase (NOX) isoforms are inhibited by celastrol with
a dual mode of action. Br J Pharmacol 2011, 164(2b):507–520.
Churg A, Marshall CV, Sin DD, Bolton S, Zhou S, Thain K, Cadogan EB, Maltby J,
Soars MG, Mallinder PR, Wright JL: Late intervention with a myeloperoxidase
inhibitor stops progression of experimental chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2012, 185(1):34–43.
Zheng JP, Kang J, Huang SG, Chen P, Yao WZ, Yang L, Bai CX, Wang CZ, Wang C,
Chen BY, Shi Y, Liu CT, Chen P, Li Q, Wang ZS, Huang YJ, Luo ZY, Chen FP, Yuan JZ,
Yuan BT, Qian HP, Zhi RC, Zhong NS. Effect of carbocisteine on acute exacerbation of chronic obstructive pulmonary disease (PEACE study): a randomised placebo-controlled study. Lancet 2008, 371:2013–2018.
Ross D, Norbeck K, Moldeus P: The generation and subsequent fate of glutathionyl radicals in biological systems. J Biol Chem 1985, 260:15028–15032.
Marrades RM, Roca J, Barbera JA, de Jover L, MacNee W, Rodriguez-Roisin R: Nebulized glutathione induces bronchoconstrictionin patients with mild
asthma. Am J Respir Crit Care Med 1997, 156(2Pt 1):425–430.
Meister A, Anderson ME: Glutathione. Annu Rev Biochem 1983; 52:711–760.
Moretti M, Bottrighi P, Dallari R, Da Porto R, Dolcetti A, Grandi P, Garuti G, Guffanti
E, Roversi P, De Gugliemo M, Potena A: Equalife Study Group: The effect of longterm treatment with erdosteine on chronic obstructive pulmonary disease: the EQUALIFE Study. Drugs Exp Clin Res 2004; 30(4):143–152.
Moldèus P, Cotgreave IA, Berggren M: Lung protection by a thiol-containing
antioxidant: N-acetylcysteine. Respiration 1986, 50(suppl 1):31–42.
Bridgeman MM, Marsden M, MacNee W, Flenley DC, Ryle AP: Cysteine and glutathione concentrations in plasma and bronchoalveolar lavage fluid after
treatment with N-acetylcysteine. Thorax 1991, 46(1):39–42.
Kasielski M, Nowak D: Long-term administration of N-acetylcysteine decreases hydrogen peroxide exhalation in subjects with chronic obstructive pulmonary disease. Respir Med 2001; 95:448–456.
De Benedetto F, Aceto A, Dragani B, Spacone A, Formisano F, Pela R, Donner CF,
Sanguinetti CM: Long-term treatment oral N-actylcysteine (NAC) reduces
exhaled hydrogen peroxide in stable COPD. Pulm Pharmacol Ther2005, 18(1):
41–47.
Decramer M, Rutten-van Mölken M, Dekhuijzen PN, Trooster T, vanHerwaarden C,
Pellegrino R, van Shayck CP, OlivieriD, Del DonnoM, De Backer W, Lankhorst I, Ardia
A: Effects of N-acetylcysteine on outcomes in chronic obstructive pulmonary diseases (Bronchitis Randomized on NAC Cost-Utility Study, BRONCUS): a randomised placebo-controlled trial. Lancet 2005, 365(9470):1552–
1560.
Sutherland ER, Crapo JD, Bowler RP: N-Acetylcysteine and exacerbations of
chronic obstructive pulmonary disease. COPD 2006, 3(4):195–202.
Stav D, Raz M: Effect of N-acetylcysteine on air trapping in COPD: a randomized placebo-controlled study. Chest 2009, 136(2):381–386.
Tse HN, Raiteri L, Wong KY, Yee KS, Ng LY, Wai KY, Loo CK, Chan MH: High-dose Nacetylcysteine in stable COPD: the 1-year, double-blind, randomized,
placebo-controlled HIACE study. Chest2013, 144(1):106–118.
Zheng JP, Wen FQ, Bai CX, Wan HY, Kang J, Chen P, Yao WZ, Ma LJ, Li X, Raiteri L,
Sardina M, Gao Y, Wang BS, Zhong NS; PANTHEONstudy group: Twice daily Nacetylcysteine 600 mg for exacerbations of chronic obstructive pulmonary disease (PANTHEON): a randomised, double-blind placebo-controlled trial. Lancet Respir Med 2014, 2(3):187–194.
RUBRICA
Notiziario AIMAR
a cura del Segretario Nazionale Mario Polverino
email: [email protected]
Il 26/5/2014, presso l’Hotel Michelangelo di Milano, si è
svolto il consiglio direttivo di AIMAR per fare il punto
della situazione sulle attività della Società. Il presidente
De Benedetto ha illustrato innanzitutto i rapporti con
FederAnziani, che è una forte associazione con notevole
penetrazione sul territorio e importanti legami con le
Istituzioni. Agli inizi di luglio il nostro Presidente ha incontrato Roberto Messina, Presidente di FederAnziani,
per stringere un’alleanza strategica anche in vista del prossimo Congresso Nazionale AIMAR 2015. Messina ha assicurato la presenza all’evento di una folta delegazione di
MMG, visti gli ottimi rapporti in corso fra questi ultimi e
FederAnziani. Inoltre ha anche consigliato di inserire
corsi per farmacisti perché convinto, grazie ai rapporti
che FederAnziani ha con i farmacisti, di poter assicurare
la loro partecipazione al nostro Congresso in numero
congruo.
Come ulteriore segnale di un’alleanza strategica fra AIMAR
e FederAnziani, il Presidente Messina ha chiesto al nostro
Presidente di entrare a far parte come loro esperto in una
Commissione Consultiva Tecnico-Scientifica di AIFA sulla
problematica della corretta aderenza alla terapia inalatoria.
Naturalmente il Presidente AIMAR ha accettato.
Il Tavolo ora risulta così costituito:
• Roberto Messina, Presidente FederAnziani
• Giuseppe Pozzi, Presidente Corte di Giustizia Popolare
per il Diritto alla Salute e Vice Presidente FederAnziani
• Dr. Fernando De Benedetto, Comitato Scientifico FederAnziani
• Prof. Francesco Blasi, Ordinario di Malattie Respiratorie
Università di Milano
• Prof. Giorgio Walter Canonica, Ordinario di Malattie
Respiratorie Università di Genova.
Riguardo ai rapporti con l’industria, molteplici sono i
progetti avviati da AIMAR nel secondo trimestre 2014 o
in fase di partenza nel secondo semestre dell’anno: Novartis, Chiesi (“Asthma Update 2014”), Menarini (“Dr.
Tulp”), GSK (atti della III Consensus Conference AIMAR
2013), Biofutura (“Diagnosi precoce della BPCO”con le
tre Società principali). In particolare quest’ultimo evento
sarebbe anche l’occasione per la diffusione delle Linee
Guida Intersocietarie.
Per quanto riguarda gli apporti intersocietari, si sta lavorando su una bozza di intenti e il Presidente De Benedetto,
con una mail, ha ancora una volta sollecitato una riunione
ai Presidenti delle altre due società (AIPO e SIMeR) per
riallacciare le fila del discorso. Il presidente AIPO, De
Michele, ha risposto alla mail confermando la disponibilità
all’incontro. Vi terremo informati sugli sviluppi.
Infine il IV Congresso Nazionale AIMAR di Pescara 6-9
maggio 2015. Si è chiesto ai Presidenti regionali di concentrare tutte le energie (economiche) del 2015 sul Congresso Nazionale di Pescara, dove sono stati previsti spazi
perché ogni singolo direttivo regionale possa riunirsi.
XI
MRM
RUBRICA
Aggiornamento
sui progetti AIMAR
Multidisciplinary Respiratory Medicine dedica questa rubrica all’aggiornamento sui
progetti di ricerca e di studio organizzati da AIMAR: questa modalità consente un filo
diretto tra AIMAR e tutti gli Associati per conoscere sempre e tempestivamente tutto
quanto concerne l’attività scientifica ed operativa dell’Associazione.
email: [email protected]
IV Congresso Nazionale AIMAR, Pescara 6-9 maggio 2015
Alberto Visconti
Segreteria Scientifica Progetti AIMAR
Da mercoledì 6 a sabato 9 maggio 2015: avete già appuntato queste date nelle vostre agende personali? Qualora
non l’abbiate ancora fatto, non esitate oltre e riservate la
vostra disponibilità per questi giorni: solo così non correrete il rischio di perdere uno tra gli appuntamenti più
importanti del prossimo anno nel panorama medicoscientifico italiano e internazionale.
Nella splendida cornice di Pescara e all’interno della
grande area attrezzata del Palacongressi d’Abruzzo si svolgeranno la IV edizione del Congresso Nazionale AIMAR
e la ottava edizione della International Conference on Management & Rehabilitation of Chronic Respiratory Failure:
quattro giorni intensi di lavori scientifici strutturati in un
format completo dal forte carattere innovativo e multidisciplinare.
Rispettando la tradizionale alternanza “nord-sud” che caratterizza da sempre la scelta della location del Congresso
Nazionale AIMAR, dopo Stresa (2004), Napoli (2009) e
Torino (2012) l’evento principe della nostra Associazione
torna nel centro-sud Italia sulle coste adriatiche d’Abruzzo
a Pescara-Montesilvano. Sede del meeting sarà il Palacongressi d’Abruzzo, una innovativa struttura polifunzionale
ad alta capacità recettiva strategicamente posizionata a
soli 5 km dal centro cittadino e ben interconnessa, qualunque mezzo di trasporto si voglia utilizzare per raggiungerla (in auto, a soli 500 metri dal casello autostradale PEMontesilvano; in treno, a meno di 10 minuti dalla stazione
ferroviaria e in aereo, a una distanza di soli 10 km dall’Aeroporto d’Abruzzo ove sono disponibili collegamenti con
Roma, Torino, Milano, Londra, Francoforte, Parigi, Bruxelles, New York).
L’offerta funzionale della struttura, oltre a garantire il perfetto supporto logistico-organizzativo all’evento congressuale, si completa con ben 5 hotel nel raggio di 500 metri
dalle sale dei lavori per oltre 900 camere disponibili: di
fatto la perfetta risposta ai requisiti tecnici e di ospitalità
necessari per la realizzazione di un evento della portata
del IV Congresso Nazionale AIMAR.
Dal punto di vista scientifico l’evento si articolerà su 127
ore complessive di lavori, ripartite tra track nazionale (40
ore), track internazionale (previste 16 ore di corsi advanced), corsi teorico-pratici sia di base che advanced (11
corsi per complessive 56 ore) e due corsi teorico-pratici
dedicati a professioni paramediche (infermieri professionali e fisioterapisti per un totale di 15 ore).
All’interno di questo vasto e articolato quadro si innesterà
un programma scientifico fortemente innovativo e multidisciplinare concepito da un Board Scientifico di primaria
importanza ed eterogeneo, costituito da affermati Specialisti “Senior” in Malattie Respiratorie e giovani Pneumologi di riconosciuta valenza nazionale.
Proprio in questi giorni (luglio 2014) il programma del
Congresso Nazionale è in fase di ultima definizione: a partire dalle proposte giunte nei mesi scorsi da tutti i compo-
XII
MRM
Rubrica
IVCONGRESSO
NAZIONALE AIMAR
8
th
International Conference
on Management & Rehabilitation
of Chronic Respiratory Failure
PESCARA
6-9 maggio 2015
Segreteria organizzativa
Segreteria Scientifica/Provider
srl
Via San Gregorio, 12
20124 Milano
Tel + 39 02 89693750
Fax + 39 0322 091808
Mail: [email protected]
Via Martiri della Libertà, 5
28041 Arona (NO)
Tel + 39 393 9117881 - Fax + 39 0871 222024
Mail: [email protected]
Web: www.aimarnet.it
nenti del Board Scientifico si sta componendo un’ampia e
articolata tavola sinottica caratterizzata da argomenti
scientifici di sicuro interesse, dalla perfetta alternanza tra
corsi e sessioni frontali e dal miglior equilibrio tra momenti teorici e pratici.
Nel contesto dei lavori saranno inoltre dedicati spazi alla
presentazione di documenti e/o progetti prodotti con altre
Società Scientifiche, a corsi interattivi a piccoli gruppi di
carattere teorico-pratico sia di livello base che avanzato e
a corsi con faculty internazionale in lingua inglese con traduzione simultanea.
Le due track (nazionale e internazionale) del Congresso
saranno coordinate da altrettanti Comitati Scientifici
composti sia da nomi di spicco della Pneumologia italiana
e internazionale che da giovani e valenti “nuove firme”
della Medicina Respiratoria italiana: l’obiettivo di AIMAR
per questa edizione del suo Congresso è porre l’accento
sul futuro puntando su quei professionisti che avranno
davvero in mano il destino della disciplina medica respiratoria negli anni a venire.
Come sempre l’intero Congresso (per le singole giornate)
e tutti i corsi di formazione programmati saranno accreditati per le professioni di Medico Chirurgo e per Personale Paramedico secondo il programma nazionale di Educazione Continua in Medicina (ECM) e, naturalmente, il
Provider dell’evento sarà la nostra stessa Associazione (ricordiamo che AIMAR è stata confermata lo scorso settembre nel ruolo Provider ECM permanente – accreditamento N.172).
A poco meno di un anno dalla data di apertura, la macchina organizzativa del IV Congresso Nazionale è già da
tempo in moto e procede spedita verso l’obiettivo: nulla
può essere lasciato al caso poiché la realizzazione di un
evento di questa portata richiede una perfetta sinergia
sotto ogni aspetto.
Il supporto allo sforzo messo in campo da AIMAR e dai
partner coinvolti (su tutti la Segreteria Organizzativa –
Dynamicom S.r.l.) è dimostrato sin da ora nei fatti e a tutti
i livelli: è rilevante l’interesse suscitato dal Congresso nel
panorama medico-scientifico nazionale e internazionale,
nonché numerose le partecipazioni già confermate da
parte di eminenti relatori italiani e non (nutrita sarà la
“pattuglia” dal nord America - USA e Canada – e dal nord
Europa) e infine, non da ultimo, sono importanti i consensi ottenuti dal mondo dell’industria e delle istituzioni.
Nel corso dei prossimi mesi, da queste pagine e attraverso
i nostri canali classici di informazione, vi daremo un costante e preciso resoconto circa l’evoluzione dei lavori in
corso; per gli aggiornamenti in tempo reale sarà a disposizione un nuovo sito web ufficiale dedicato al IV Congresso Nazionale AIMAR (www.aimar2015.it, attualmente
in fase di realizzazione) che affiancherà le sezioni dedicate
all’evento sul nostro sito ufficiale (www.aimarnet.it): vi
chiediamo di non lasciarci soli in questa importante sfida,
poiché il vostro supporto, la vostra condivisione e la vostra
attività di diffusione anche territoriale delle informazioni
sarà per AIMAR fondamentale nella riuscita del progetto.
Appuntamento a Pescara dal 6 al 9 maggio 2015 per la IV
edizione del Congresso Nazionale AIMAR e la ottava edizione della International Conference on Management &
Rehabilitation of Chronic Respiratory Failure: non dimenticatelo!
XIII
MRM
RUBRICA
Comunicazione
a cura della Redazione
email: [email protected]
Sindrome delle apnee ostruttive nel sonno e patente di guida:
aggiornamento della normativa comunitaria europea
Antonio Sanna
UOC Pneumologia, Azienda USL3 Pistoia, Ospedale San Jacopo, Pistoia, Italia
email address: [email protected]
Il 2 luglio 2014 è stata pubblicata sulla Gazzetta Ufficiale
dell’Unione Europea la direttiva 2014/85/UE [1] della Commissione che modifica la direttiva 2006/126/CE [2] del
Parlamento Europeo e del Consiglio concernente la patente
di guida. Nell’allegato III della direttiva 2006/126/CE la sezione 11 è stata sostituita con l’inserimento di quanto segue:
Sindrome delle apnee ostruttive nel sonno
11.2. Nei paragrafi seguenti, una sindrome da apnea ostruttiva notturna moderata corrisponde a una serie di apnee e
ipopnee (indice di apnea-ipopnea) comprese tra 15 e 29 l’ora, mentre una sindrome da apnea ostruttiva notturna
grave corrisponde a un indice di apnea-ipopnea pari o superiore a 30, e sono entrambe associate ad un eccessiva sonnolenza diurna.
11.3. Il richiedente o il conducente in cui si sospetti una sindrome da apnea ostruttiva notturna moderata o grave deve
essere sottoposto a un consulto medico approfondito prima dell’emissione o del rinnovo della patente di guida. A tali
soggetti si può consigliare di non guidare fino alla conferma della diagnosi.
11.4 . La patente di guida può essere rilasciata ai richiedenti o conducenti con sindrome da apnea ostruttiva notturna
moderata o grave che dimostrano un adeguato controllo della propria condizione, il rispetto delle cure adeguate e il
miglioramento della sonnolenza, se del caso, confermato dal parere di un medico autorizzato.
11.5. I richiedenti o i conducenti in cura per sindrome da apnea ostruttiva notturna moderata o grave sono soggetti a
un esame medico periodico, a intervalli che non superano i tre anni per i conducenti del gruppo 1 e un anno per i conducenti del gruppo 2, al fine di stabilire il livello di rispetto delle cure, la necessità di protrarle e una buona vigilanza
continua.
Tale risultato è stato possibile grazie al lavoro realizzato
negli anni scorsi dal Working Group 2 (WG) on Medicolegal implications of sleep apnea della COST Action B 26
finanziata dalla UE. Il WG2 ha raccolto e prodotto la documentazione in merito alla OSAS quale fattore di rischio
indipendente di incidenti stradali ed ha valorizzato le lacune normative in ambito comunitario per quanto concerne la OSAS e la patente di guida [3,4]. È stato inoltre
documentato che il trattamento con CPAP abbatte tale
rischio ai valori osservati nella popolazione generale. Tali
XIV
MRM
Rubrica
indicazioni e gli elevati valori di prevalenza della OSAS
nella popolazione generale hanno convinto gli organismi
comunitari competenti in materia di rilascio o rinnovo
della patente che la OSAS è un problema di salute pubblica per i cittadini europei. La normativa europea, una
volta approvata dal Parlamento Italiano, renderà obbligatori gli interventi diagnostici, terapeutici e di follow up
richiesti per il conseguimento dell’idoneità psico-fisica
alla guida. In Italia, a fronte di una prevalenza stimata
pari a non meno di circa due milioni di soggetti adulti affetti da OSAS, sono infatti solo circa 100.000 gli individui
in trattamento. Ciò indica l’inadeguatezza del sistema sanitario a soddisfare la necessità di fornire salute ai soggetti
con OSAS. Per soddisfare gli obblighi normativi di cui
sopra il sistema sanitario dovrà quindi incrementare significativamente e rapidamente il numero di prestazioni
clinico-strumentali per diagnosi, trattamento e follow up
dei soggetti con OSAS. AIMAR, anche in quanto com-
ponente del Tavolo Tecnico Interdisciplinare “Sonnolenza
e Sicurezza nei pazienti OSAS” [5], è quindi chiamata a
produrre percorsi clinico-assistenziali finalizzati alla valutazione dell’idoneità psico-fisica alla guida che siano
facilmente e rapidamente fruibili per il cittadino e sostenibili per il sistema sanitario.
Bibliografia
1. [http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=OJ:L:2014:194:TOC]
2. [http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2006:403:0018:0060:
IT:PDF]
3. Alonderis A, Barbé F, Bonsignore M, Calverley P, De Backer W, Diefenbach K, Donic
V, Fanfulla F, Fietze I, Franklin K, Grote L, Hedner J, Jennum P, Krieger J, Levy P, McNicholas W, Montserrat J, Parati G, Pascu M, Penzel T, Riha R, Rodenstein D, Sanna A,
Schulz R, Sforza E, Sliwinski P, Tomori Z, Tonnesen P, Varoneckas G, Zielinski J, Kostelidou K; COST Action B-26: Medico-legal implications of sleep apnoea syndrome: driving license regulations in Europe. Sleep Med 2008, 9:362–375.
4. Rodenstein D; Cost-B26 Action on Sleep Apnoea Syndrome: Driving in Europe:
the need of a common policy for drivers with obstructive sleep apnoea
syndrome. J Sleep Res 2008, 17:281–284.
5. Sanna A: Il Tavolo Tecnico Interdisciplinare “Sonnolenza e Sicurezza nei pazienti OSAS. Multidiscip Resp Med 2013, 8:XXVII–XXVIII.
XV
MRM
RUBRICA
L’angolo della Cultura (non solo Medicina…)
a cura della Redazione
email: [email protected]
C’era una volta il salone del barbiere
Francesco Iodice
Già Direttore U.O. s.c. di Fisiopatologia Respiratoria, Ospedale A. Cardarelli, Napoli, Italia
email address: [email protected]
“Il tempo di farmi la barba – disse il maresciallo – e saprò se
questo Zecchinetta è uno del paese: il mio barbiere conosce tutti”.
Leonardo Sciascia, Il giorno della civetta.
“Se mi è capitato di avere acconciati
i capelli a scaletta da un barbiere, te la ridi...”
Marziale, Epitaffio
Mi trovavo l’estate scorsa lungo il corso principale di Sulmona e rimasi colpito da una barberia simile a quella dove
da ragazzo si esibiva il mio figaro (in spagnolo, figaro significa bolero, giacca corta, indumento che era come una
divisa, quindi sinonimo di barbiere). Il salone non era probabilmente stato mai rinnovato, rivestito di legno, assomigliava ad una farmacia, e, come le farmacie ottocentesche, forse era anche asilo di conversazioni pettegole.
Entrai con la scusa di chiedere informazioni e notai subito
i grandi specchi e gli occhi indagatori che ci rimbalzavano
dentro, un cliente meticolosamente insaponato sulla poltrona, gli astanti sulle panche, la lentezza antica nei gesti
del barbiere e tutta un’atmosfera che disponeva alla confabulazione. Avevo davanti il luogo più autentico della socialità meridionale dove ogni sussulto della vita del paese
veniva passato al pettine fine, con sorniona noncuranza,
vedendo senza vedere, dicendo senza dire. Le pareti della
stanza e i battenti della porta che si aprivano all’esterno,
lungo il marciapiede, mostravano vetrine e specchi con
antichi arnesi frammisti a vecchi dollari portati dagli emigrati nelle vacanze estive o natalizie: strumenti improbabili
(con tanto di pinze, tenaglie, punteruoli) ferri più vicini a
una sala di tortura dentistica o a un falegname che a un
barbiere. Non ci si può non chiedere: che ci facevano lì
ben otto tenaglie? Fu per me una rivelazione. Mi trovai in
un luogo della mente dove, immergendosi, anche i ricordi
della nostra vita vengono prima o poi, inesorabilmente al
pettine. Un reportage della memoria che va oltre la memoria. Le «madeleine» di ogni uomo – così come quei
piccoli biscotti a forma di conchiglia scatenavano in Marcel
Proust i ricordi del passato – portano a viaggiare nella
memoria anche di stanze – come quelle dei saloni da barba
– che profumavano di lozioni, schiuma, sapone e borotalco, di morbida crema e brillantina. Stanze piene di ampolle, affilati rasoi, insomma di preziose mercanzie dove
si praticava il rito antico del taglio dei capelli, anche della
barba se si è adulti, della tinta per quelli che non vogliono
accettare l’inesorabilità del tempo. Già, il tempo... Un viaggio per immagini che non incede alla nostalgia ma che
racconta con ironia e occhio sensibile l’universo di un perenne «altrove» come può essere la stanza di un barbiere,
un po’ lettino psicanalitico, un po’ ritrovo da bar sport,
XVI
MRM
Rubrica
assemblea di politica internazionale e ritrovo di un maschilismo senza frontiere e latitudini. Insomma piccolo
club per soli uomini dove alle pareti convivono da sempre
in una naturale esposizione donne completamente nude
con le estatiche immagini di Cristo o del Papa.
Oggi invece: “Sphynx de la Coiffure” sfinge della pettinatura, hairdresser, hair stylist ”unisex”, hair care, haute
couture, coiffeur pour homme. Se lo avessero saputo i
loro predecessori che sarebbero finiti nel profondo anonimato di un’insegna stilizzata, forse i più nobili “barbieri”
non sarebbero mai esistiti. Il progresso, le grandi città, le
lunghe distanze, le corse affannose contro il tempo sono
termini di paragone piuttosto stridenti messi a confronto
con le atmosfere dei “saloni da barba” di un tempo, eppure
non lontanissimo.
Mastu Gegè era il barbiere della nostra famiglia al paese,
famiglia per modo di dire, perché ero l’unico cliente in
quanto mio padre si faceva barba e capelli in una barberia
cittadina a piazza Capodichino, dove insegnava; il resto
della famiglia era di genere femminile e non andava dal
barbiere. I miei amici, una volta giunti attorno ai sedici
anni, mettevano i pantaloni lunghi e ogni mattina ansiosamente si controllavano allo specchio per vedere se nottetempo era capitato il miracolo della barba. E con quanto
orgoglio i più precoci potevano finalmente proclamare ai
compagni invidiosi: “M’è spuntata ‘a barba, vaco add’o mastu
Gegè”. Il salone in verità non meritava l’accrescitivo: era
una stanza di poco più di quattro metri dotato di uno sgabuzzino posteriore. Dentro ci stavano tre poltrone da barbiere, sei sedie per i clienti in attesa, un portaombrelli, un
attaccapanni, due sputacchiere. A tredici anni odiavo tagliarmi i capelli, quella macchinetta che mi faceva un’impietosa tabula rasa del mio occipite mi procurava incubi
notturni. Il contrario era per la barba che desideravo ardentemente tagliare – anche se chiamare barba quella ridicola peluria sopra il labbro, sul mento e sotto le basette che
m’era appena fiorita – sarebbe come chiamare capelli la lanugine sul cranio di un neonato. Le parti si invertirono
quando quella lanugine – che frettolosamente chiamavamo
baffi – cominciò a darmi fastidio. Facevo pressioni ma mio
padre – timoroso di aggiungere al prezzo dei capelli quello
della barba – rispondeva:” Aspetta, sennò cresceranno ancora di più e dal barbiere ci dovrai andare sempre più spesso”.
E un giorno Mastu Gegè mi acchiappò al laccio. Dopo aver
tagliato (o rapato?) i capelli, cominciai a fare cenno ai “baffi”;
a lui non sembrò vero. “Li tagliamo? E tagliamoli” esclamò
trionfante: aveva acchiappato finalmente una nuova barba.
Don Gegè era bravissimo e autodidatta. Infatti, non
aveva affrontato la prova del rasoio sul palloncino gonfio
o il bruciante test di dottrina tricologica al quale fu sotto-
Attrezzi di un vecchio salone di barbiere.
posto l’aspirante barbiere Nino Manfredi (nel film di Dino
Risi “Straziami ma di baci saziami”) dal vecchio ed esperto
titolare della bottega: – Sfumi? «Punta e forbice». – Macchinetta? «Rifuggo». Più il barbiere è illetterato più è garanzia di spensierata gratuità verbale. Dal barbiere tutto
si può dire perché niente ha rigore e nulla è più rigoroso
di una lama affilata. Ed era un mondo tutto maschile,
greve e caprone. Alzandosi dalla sedia girevole, il cliente
si toccava con la mano a coppa e i baffi erano a “camminata
di furmicula”, a cammino di formica, perché “le femmine
vogliono sentire la polpa ma ci piace pure il solletico”.
I figari del tempo si comportavano come se avessero
superato un “esame auricolare”, perché «un bravo barbiere
deve essere un bravo ascoltatore, cioè essere capace di
ascoltare con la piena fioritura dei sensi ogni cliente che
entra nel suo salone. In altre parole deve essere capace di
un ascolto altruistico, decentrato, profondo. Il suo deve
essere un “ascoltare per” e non già un “ascoltare contro”.
Egli deve saper mettersi dal punto di vista dei clienti...
Deve essere un professionista dell’ascolto poiché deve
riuscire a capire quali messaggi i suoi clienti intendono
inviare con i loro capelli. Sono le barbe ma non i barbieri
a fare la storia, i barbieri le maneggiano ma non è una
necessità deontologica sapere che ci sono barbe e barbe:
Fare il barbiere non era soltanto una questione di barba,
baffetti, capelli, brillantina Linetti o Venus, c’era la panacea
di tutti i mali, c’erano innumerevoli funzioni da assolvere:
una sociale (a sostegno dei minori che pur di non perdersi
per strada aiutavano il maestro, fanciulle da maritare);
una culturale (si leggevano i giornali); una ricreativa (si
suonavano chitarre, mandolini, fisarmoniche), una politica,
una medica, etc… Il barbiere era una vecchia volpe! Con
la scusa del taglio a sfumatura alta “alla Re Umberto II”,
XVII
MRM
Rubrica
Un'antica barberia.
bassa “alla Mascagni” o lo “scalpo alla Kociss”, e una scorta
inesauribile di barzellette, s’intrufolava nelle questioni che
contano e lì faceva il bello e cattivo tempo, ed è inutile
dirlo che non lo faceva gratis… La bottega del barbiere
(‘tonsor’ nell’antica Roma), era disposta come segue: alle
pareti del locale erano appesi degli specchi sui quali i passanti controllavano la propria condizione pilifera; al centro
una poltrona su cui siede il cliente da riordinare coperto
da una salvietta, grande o piccola, oppure da un camice;
attorno lavoravano il maestro e i suoi garzoni per tagliare
o sistemare i capelli secondo la moda; su una panca o
delle sedie altri clienti attendevano il loro turno.
Quando negli anni ’60 e ’70 ci si accomodava su quelle
poltrone rosse di pelle nel salone del barbiere, prima o poi,
qualcuno avrebbe raccontato un fatto, un aneddoto o una
barzelletta capace di farvi passare un momento di buon
umore. Si assaporavano vicende che appartenevano al
tempo che fu, raccontate con un linguaggio dialettale: amori
platonici o rozzamente carnali (e probabilmente del tutto
inventati), esoterismi inspiegabili e morti provvidenziali,
cornuti dalla coscienza cristallina, mestieri dimenticati, invidie, ripicche, truffe riuscite o sventate e scherzi. Entrate,
accomodatevi nel salone del barbiere. Quando don Gegè
finiva, lo sentivamo declamare soddisfatto con la sua voce
baritonale: “Ecco, servito. Ragazzo spazzola!”. E o’ russo,
cioè Mimì il rosso, completava l’opera.
Il mastro – come spesso veniva chiamato – era una
sorta di confessore; da un lato: ricettacolo di segreti, mormorii, indiscrezioni; dall´altro, confidente ideale, prezioso
informatore. Sereno e grave come un medico, inforcava
gli occhiali e mi trattava sapientemente la faccia. Diceva
Vitaliano Brancati: “Dal barbiere, più che una rasatura,
mi aspetto una diagnosi”. E spesso la diagnosi i barbieri
la davano davvero: della situazione politica, dell´ultima
crisi matrimoniale, dell´improvvisa bancarotta di un
cliente. Per non dire delle cure riservate non tanto a barba
e capelli, quanto ai più disparati malanni. Non hanno infatti solo praticato l´attività di cavadenti, i barbieri, disposti come erano ad affrontare anche le emergenze più
preoccupanti, praticavano una sorta di bassa medicina.
Bassa per la provenienza insolita dell´assistenza medica,
ma anche per i risultati spesso raggiunti: basta leggere il
capolavoro di François Rabelais, “Gargantua e Pantagruel”,
in cui troviamo barbieri che cercano di curare, e che invece quasi sempre accorciano la vita dei malcapitati. Anche se è vero che tra il Medioevo e il Rinascimento, i barbieri erano iscritti alla Corporazione dei medici e degli
speziali. Barbieri tuttofare (c´è pure il parrucchiere alchimista e astrologo delle “Mille e una notte”, che si
chiama Taciturno e invece è uno che non la smette di
parlare, e quello che, con rara competenza, censura le biblioteche, come nel “Don Chisciotte”):
Don Gegè, come tutti i barbieri, era gentile e ogni anno
distribuiva in regalo un calendarietto ai clienti. Erano piccoli, da portarsi nel taschino, infilati dentro a una bustina
di carta speciale. A forma di libretto tenuto insieme da un
cordoncino di seta, chiuso in una busta di cellophan, aveva
in capo a ogni pagina, ogni mese, una deliziosa donnina
scollatuccia; in alcuni, si arrivava a carnose, rubensiane
femmine discinte. Il loro profumo dolciastro era particolare, credo unico al mondo, di cipria, di biancheria, d’intimità femminile... Veri e propri capolavori. Per l’epoca,
erano molto osé, oggi andrebbero bene in un educandato.
Alla domenica – perché i barbieri lavoravano anche la
domenica, il loro giorno di riposo era il lunedì – nel salone
di don Gegè c’era il concertino eseguito dal duo Bozzaotra-Pennasilico di grande fama paesana. Bozzaotra al
mandolino, era un ferroviere, Pennasilico, falegname, suonava la chitarra. Naturalmente non si potevano esibire
nel salone, era troppo stretto; e allora si fermavano sul
marciapiede ingombrando la porta del salone. Si prestavano anche a serenate notturne (allora usavano) che gli
innamorati facevano eseguire sotto le finestre delle loro
belle. Certe volte le serenate finivano con la fuga precipitosa del duo, inseguito da qualche padre geloso che non
gradiva la gentile attenzione verso la figlia. Il loro reper-
XVIII
MRM
Rubrica
torio pescava soprattutto nella grande canzone napoletana
e frequenti erano i bis. Era però anche duro all’occorrenza.
Una domenica don Mimì “o’ camuso”, noto villico dal
naso orribile a “papaccella”, peperone, sputò per terra
alla destra della sedia; il ragazzo Salvatore “o’ chiumarro”
(detto così per la folta chioma) spostò allora a destra la
sputacchiera che si trovava a sinistra. Poco dopo, o’ camuso sputò a sinistra ancora a terra e il ragazzo riportò
la sputacchiera a sinistra. Allora, Mimì con rabbia gridò:”
Guagliò, se non ti puorti ‘sta cazzarola, ci sputo a’ dinto”.
E mastu Gegè trionfante gridò rivolto al villico: “Final-
mente t’e’ trasuto into ‘a scuccia!, finalmente hai capito!”
Nel 1946 il concertino finì – c’era la fame nera e la
gente aveva altro a cui pensare – per cui il salone di don
Gegè divenne triste e silenzioso. Camilleri lascia intendere
di cosa è morta la barberia meridionale dove andava mal
volentieri perché intuiva che proprio lì, nella cuticola, si
annida la libertà di pensiero che nessuno riesce a domare
e a pettinare (o forse, dicono i maligni, perché era già
calvo). Secondo il creatore del commissario Montalbano,
fu il il ‘68 a seppellire il genere: Mao non si lavava neppure
i denti perché diceva, “le tigri non lo fanno”.
Gironzolando per Napoli
Francesco Iodice
Già Direttore U.O. s.c. di Fisiopatologia Respiratoria, Ospedale A. Cardarelli, Napoli, Italia
email address: [email protected]
“Non c'è tristezza che, camminando, non si attenui e lentamente si sciolga”.
Romano Battaglia, Foglie, 2009
Dopo ore alla scrivania si sente il bisogno di fare qualcosa
di piacevole e che c’è di meglio del desiderio di un oggetto
gradito e uscire a comprarlo? Forse pochi si sono appassionati ad un calamaio di inchiostro verde scuro, ma in
certi casi può diventare estremamente desiderabile sostituire quello esaurito e usarlo come motivo, come scusa
per attraversare la città tra le quattro e le sei del pomeriggio. Quando ci assale il desiderio di vagabondare per
le strade, preparandoci diciamo: “Mi devo assolutamente
comprare l’inchiostro verde; non quello qualunque, ma
quello speciale dal tono scuro con riflessi rossastri, quello
che produce don Salvatore a Porta Capuana, dall’altra
parte di Napoli, nel vicoletto dietro l’ex Pretura”. Non
siamo assolutamente certi che si venda solo là, ma la finzione ci consente di camminare a lungo. Come se con
questa scusa potessimo abbandonarci senza remore al
massimo piacere che la vita cittadina offre in inverno: vagabondare per le via di Napoli.
L’ora deve essere il tramonto e la stagione giusta l’inverno, perché l’effervescenza dell’aria e le strade affollate
sono particolarmente piacevoli d’inverno. Non siamo distratti come d’estate dall’afa e dal desiderio dell’ombra, di
solitudine e di dolci brezze che spirano dal mare. Le ore
della sera, inoltre, ci danno più irresponsabilità che il
buio e la luce artificiale permettono. Non siamo più completamente noi stessi, ci liberiamo della personalità che i
nostri amici ci riconoscono e diventiamo parte di quel
grande esercito di anonimi pedoni che camminano sui
marciapiedi: la loro compagnia è estremamente piacevole,
peccato che sia disturbata dai clacson delle auto (spesso
enormi e inutilmente ingombranti). Ma, dopo la solitudine
davanti al pc, riusciamo a sopportare anche questa confusione rumorosa.
Nella nostra stanza siamo circondati da oggetti che
rinforzano i nostri ricordi, ma che conosciamo benissimo:
il vaso di porcellana azzurra e bianca sulla tavola è stato
comprato a Bari in una ventosa giornata dietro la chiesa
di San Nicola, dopo le insistenti lamentele di una vecchietta che ripeteva di stare per morire di fame. Sentendoci un po’ in colpa, pur sospettando di essere imbrogliati,
lo portammo con noi in albergo dove, alle tre di notte,
restammo oltre un’ora (in sette) chiusi nell’ascensore perché il portiere, essendo alla prima notte di lavoro, non
sapeva dove fossero le chiavi. E, prima di salire, avevamo
anche trovato un malinconico inglese che – ebbro su una
poltrona – voleva rivelarci i segreti della sua anima. Tutto
questo si solleva come una nuvola e lo sguardo cade sul
tappeto dove c’è quella impronta del ferro da stiro rovente
XIX
MRM
Rubrica
scappato dalle mani della mite e silenziosa Miluka. Ma
chiudendoci la porta alle spalle, ci prende una smania
che il cuor volge al desio dell’aperto.
Com’è bella d’inverno una strada allo stesso tempo rivelata e misteriosa: idealmente possiamo immaginare che,
al posto dei palazzoni dell’era laurina, ci siano viali alberati
e la simmetrica disposizione delle porte e finestre attorno
al verde alberato, come in certe piazze di Londra, per
esempio Gordon Square, forse la più bella di tutte. Sotto
i lampioni passano frettolosamente uomini e donne, illuminati anche dalle vetrine, che, nonostante la loro povertà
e trasandatezza, hanno una certa aria di irrealtà come se
fossero sfuggiti alla trappola della loro vita.
Dalle scale di via Colonna, scendiamo verso il mare
attraversando la strada molto silenziosa e caratteristica.
Ci fermiamo davanti alla porta di un calzolaio per chiedere
delle stringhe per le scarpe ma, proprio in quell’istante,
entra, con la scorta di due donne, una nana che fa apparire
le sue accompagnatrici delle benevoli giganti. Lei ha
l’espressione permalosa e allo stesso tempo di scuse, che
spesso si ritrova sul viso delle persone deformi. Aveva bisogno della loro bontà, pur sentendosene offesa, ma
quando le gigantesse chiesero un paio di scarpe “per la
nostra amica”, questa pose il piede su un piccolo sostegno
e cambiò atteggiamento perché il piede era normale e armonioso. Guardatelo! Guardatelo! Sembrava dire a tutti
noi. E cominciò a chiedere una scarpa dopo l’altra, ne
provava un paio dopo l’altro: si alzava, sollevava i bordi
della gonnellina mostrando le piccole gambe e faceva una
piroetta. Pensava che i piedi sono la parte più importante
di una persona e, quindi, se sono normali, anche il resto
del corpo è uguale ai piedi. La commessa dovette dirle
qualcosa perché assunse un’espressione estatica che perdette quando le gigantesse la costrinsero a scegliere un
paio e ad andar via. Le ritornò la vecchia scontrosità e,
giunta per strada, era ridiventata una nana e nient’altro.
In quell’ora crepuscolare Napoli è veramente bella: scesi
verso il mare ammiriamo via Caracciolo finalmente restituita ai pedoni, il disco rosso del sole sta per tuffarsi nel
mare. Insolitamente, sotto la balaustra, seduta sugli scogli
c’è una coppia: parla piano con la curiosa mancanza di
consapevolezza di se stessi che hanno gli innamorati, come
se l’importanza della loro storia d’amore richiedesse di diritto l’indulgenza di tutta la razza umana. Comincia a piovere, un vento gelido tira dal mare ma i due non se ne accorgono perché ora si baciano: auguriamo ai “colombini”
una felicità futura pari a quella presente e proseguiamo
verso la villa: tutta la vegetazione presenta boschetti di
oscurità, praticelli con alberi sparsi e, camminando lungo
la cancellata, si sentono le gocce d’acqua urtare sulle foglie,
Napoli, Decumano Maggiore, i portici di via Tribunali oggi.
i leggeri scricchiolii e brusii di ramoscelli che sembrano
suggeriti dal silenzio vespertino.
Mentre camminiamo lungo la riviera, una voce ci
chiama dal basso di una libreria; scendiamo pochi gradini
e ci troviamo in un porto sicuro gestito da Lino e Davide,
due cari amici che non vedevamo da tempo. Qui, dopo
gli splendori e le miserie della strada, recuperiamo il nostro equilibrio: i libri sono dappertutto, e siamo pervasi
da un senso di avventura. Prendiamo dallo scaffale in lato
un libro dal dorso lucido, grigio e biancastro e la nostra
fantasia ci fa sperare di incontrare un uomo che cento
anni prima, cavalcando un cavallo, volava per le praterie,
sostava nelle locande, un viaggiatore sconosciuto che beveva la sua pinta di birra, guardava le belle ragazze e i costumi locali e poi, faticosamente, metteva tutto per
iscritto, trasmettendoci un ritratto di se stesso che gli assegna un posto per sempre nell’angolo più caldo del focolare della memoria. Ma il numero dei libri è infinito, e
uno è costretto, dopo aver gettato uno sguardo veloce, ad
andarsene dopo un attimo di conversazione e ci si ritrova
per strada e si sente una frase – pronunciata da un uomo
ad una donna, entrambi maturi ma ancora giovanili –
dalla quale si potrebbe ricostruire un’intera esistenza. Lui
dice:” L’ho detto chiaramente a Olimpia…dopo averti servito una vita intera, pensi che valga meno di un soldo bucato, ma…”. Ma non si riesce ad ascoltare altro, chi sia
questa Olimpia e perché abbia posto fine ad una tempestosa relazione, non lo sapremo mai. Nell’ombra del portico due poveracci, tra un sorso e l’altro di pessimo vino,
parlano di lotterie e gratta e vinci: pensano che un giorno
la fortuna cambierà la loro vita, trasformando i loro stracci
XX
MRM
Rubrica
Palazzo Reale a Napoli.
Eleonora De Fonseca Pimentel.
in pellicce e stoffe preziose? Ma la corrente dei pedoni
passa troppo velocemente a quest’ora per lasciarci formulare tali domande. La folla corre verso casa camminando in una specie di sogno narcotico, ora che si sono
liberati dell’atmosfera greve dei loro ambienti di lavoro,
sognano, gesticolano e mormorano parole ad alta voce.
Alla fine del lungomare, ci appare – bellissimo e imponente – il palazzo reale e all’improvviso siamo tra le
due e le tre del mattino, i lampioni bruciano bianchissimi
lungo la facciata e nelle stanze: c’è una grande festa per
celebrare la neoproclamata Repubblica Napoletana; siamo
sul balcone in compagnia, tra gli altri, dell’affascinante
ammiraglio Caracciolo, del generale Championnet, di
Eleonora Pimentel Fonseca, di Gennaro Serra di Cassano,
di Domenico Cirillo e Mario Pagano, mentre servi in
livrea e calze di seta ci servono bibite e dolci.
Cosa ci può essere di più assurdo? Sono infatti le sei in
punto di una sera d’inverno, e ci chiediamo: “Il nostro
vero io sta nella piazza in una sera di gennaio o è quello
che si affaccia ai balconi reali per celebrare una rivoluzione? Siamo qui o siamo là? O forse la nostra personalità
è solo quella che si realizza quando diamo sfogo ai suoi
desideri, rendendoci finalmente noi stessi? Ma la vita di
relazione ci impone l’unità; per convenienza, l’uomo non
può quasi mai essere se stesso: un bancario, un impiegato,
un marito, un padre non possono essere un Lawrence
d’Arabia o un Pancho Villa. Quando aprono la porta di
casa debbono seguire una prassi routinaria: ravviarsi i
capelli con le mani, posare l’ombrello nel portaombrelli,
sorridere e baciare i propri cari, come tutti gli altri.
Ma ormai siamo giunti nella piazza di Porta Capuana,
ecco là in fondo il vicoletto del nostro cartolaio, tentenniamo un po’ sul marciapiede, poi entriamo nella piccola
bottega e, rivolti al vecchio artigiano (lui dice che produce
l’inchiostro in esclusiva), farfugliamo: “Dovrei acquistare
il solito...”. Poi la mente si ferma: dobbiamo, sempre dobbiamo fare questo o quello, non ci è concesso il semplice
divertimento senza scopo. Non è forse per questa ragione
che poco fa abbiamo creato il bisogno di comprare…ah,
sì, era un calamaio di inchiostro verde? E allora compriamolo, il vecchio sceglie la bottiglina da uno scaffale, ce la
porge, prende i soldi e scompare dietro un paravento.
In quei pochi minuti le strade si erano svuotate, la vita si
era ritirata dalle vie e si erano accese le luci nei piani superiori. Ritornando verso casa avremmo potuto parlare della
storia della nana, della festa a palazzo, dei barboni che sognavano la ricchezza, dei “morosi” che si sbaciucchiavano
sotto la pioggia e dei libri antichi nella libreria. Il camminare,
quindi, come meccanismo del raccontare, come sfondo di
vicende minime e straordinarie di persone nelle quali ci è
stato concesso di penetrare: operai, impiegati, badanti, osti
nella cantina, disoccupati e cantanti di strada. Per qualche
istante siamo evasi, entrando nei corpi degli altri?
Sì, l’evasione è il più grande di tutti i piaceri: girovagare
per le strade d’inverno è la più grande avventura. Eppure,
avvicinandoci alla porta di casa sentiamo un senso di conforto (“home sweet home”, casa dolce casa?). Entriamo:
ecco la nostra sedia dove l’abbiamo lasciata, il vaso di porcellana e l’impronta del ferro da stiro sul tappeto. Ma ecco
soprattutto – lo tocchiamo con rispettosa tenerezza –
l’unico bottino che abbiamo potuto riportare a casa fra
tutti i tesori della città, un semplice calamaio di vetro.
XXI
MRM
RUBRICA
Recensione
I racconti di un medico
Lilia Giannini
Ufficio Editoriale Novamedia
email address: [email protected]
Gennaro D’Amato, pneumologo, allergologo, professore
universitario e primario ospedaliero, da sempre coltiva la
passione per la scrittura e nutrita è la sua produzione di
articoli scientifici, sia in italiano che in inglese, alcuni pubblicati anche sulla ns. rivista Multidisciplinary Respiratory
Medicine. Tuttavia la sua passione per lo scrivere va al di
là dell’ambito scientifico, come testimonia l’ultima Sua fatica letteraria, intitolata “I racconti di un medico” ed edita
da Rogiosi. Ci spiega infatti lo stesso Autore: “Da bambino,
quando avevo il naso infilato nei libri, cominciai a pensare
che la letteratura fosse il migliore dei mondi possibili.
Avrei voluto crescere tra i libri, ma purtroppo avevano un
costo che la mia famiglia non si poteva permettere e
quindi, non essendoci ancora internet, leggevo e rileggevo
sempre gli stessi pochi libri. Entravo nelle storie che leggevo, mi accucciavo tra le righe e mi appoggiavo, col fiato
sospeso, a parole e frasi che m’incantavano. Imparavo ad
ascoltare la magia delle parole e a sentirla vibrare dentro
di me, mentre mi accarezzava il cuore e la mente”.
“Da grande, pensavo, desidererei vivere in questi mondi
di storie fantastiche, e vorrei soprattutto costruire qualcosa
di simpatico nel rispetto degli altri, anzi insieme agli altri.
Gennaro D’Amato
I racconti di un medico
Editore Rogiosi,
Napoli, 2014.
XXII
MRM
Rubrica
A volte accade di realizzare quello che sogniamo da piccoli,
magari per ventura, per un gioco bizzarro della vita che ti
getta, un giorno, in un posto, e poi in un altro, senza ritrovare sempre sapori familiari, ma avvertendo la necessità di
ricordare e trasmettere agli altri le tue esperienze. Scrivere
su un foglio bianco o al personal computer, magari su un
aereo o su un treno, quello che si è vissuto, che si pensa e
che si crea pensando, o che ci si augura che possa accadere,
significa esprimere i propri sentimenti, il proprio io, la propria vita e quello che si pensa delle speranze future, che
non dovrebbero mancare mai e che dovremmo sempre nutrire. Scrivere è un’attività stimolante e rendere gli altri partecipi del proprio vissuto, delle proprie esperienze ed emozioni, è un’attività coinvolgente, avvolta dal mistero relativo
all’accettazione o meno da parte del pubblico di quanto si
è scritto. Faccio bene o faccio male a scrivere? Faccio bene
o faccio male a rendere pubblici alcuni aspetti della mia
vita? È questo, penso, ciò che si chiede chi scrive, ed è positivo che ci sia chi ritiene utile mettere su carta esperienze
e idee, anche poco popolari o interessanti”.
“Se poi a scrivere è un medico che ha esercitato per
molti anni e tuttora esercita la sua professione, – aggiunge
ancora D’Amato – è inevitabile che negli appunti della sua
vita ci siano prevalentemente eventi di ambito e interesse
medico. Ma a ben vedere, rivelando alcuni aspetti di valore
medico e insieme umano del mio vissuto, potrei anche risultare utile ad altre persone, medici o non medici, informandole su eventi che potrebbero accadergli o consentendogli di evitare di ricadere nei propri errori. La medicina
è infatti conoscenza e sapere sia nella teoria sia nella pratica clinica, ma è anche un’arte. Perspicacia, intuito, psicologia e capacità di creare un dialogo col paziente e col
prossimo in generale rientrano nel concetto di “arte che
non rinuncia alla scienza”. È quindi giusto che la scienza,
così come l’arte, venga divulgata, non solo nelle corsie
dell’ospedale o al chiuso di laboratori, ma anche trasmettendo l’esperienza individuale con coinvolgimento, se possibile, emotivo, e magari utilizzando in modo ottimale i
social network. L’importante è crederci e operare al meglio
delle proprie possibilità”. Buona lettura.
XXIII
MRM
MRM volume 9 3-4_Layout 1 29/07/14 11:50 Pagina XXIV
RUBRICA
Meeting Calendar
WHEN
WHERE
WHAT
WHO TO CONTACT
2014
rd
September
6-10
Munich
(Germany)
ERS 24 Annual Congress
[email protected]
www.erscongress2014.org
September
22-24
Paris
(France)
Course: “Paediatric flexible bronchoscopy”
[email protected]
www.ersnet.org
September
25-27
Athens
(Greece)
Course: “Interventional bronchoscopy”
[email protected]
www.ersnet.org
October
1-3
Genova
(Italy)
FIP 2014 - XV Congresso Nazionale della Pneumologia
NeT Congress & Education, Milano
[email protected]
www.fip2014.it
@
October
6-8
Rome
(Italy)
Corso teorico-pratico di alta formazione in "Ecografia toracica
ed ecoendoscopia bronchiale"
Università Cattolica del Sacro Cuore, Rome
[email protected]
@
October
9-11
Vietri sul Mare, SA
(Italy)
VII edizione Congresso PneumoCampania
“I nuovi pilastri della saggezza pneumologia”
Top Congress and Incentive Travel, Salerno
[email protected]
www.topcongress.it
October
20-22
Alexandroupolis
(Greece)
Course: “Medical thoracoscopy 2014“
[email protected]
www.ersnet.org
October
23-24
Verona
(Italy)
1st International Workshop on Large population-based surveys
on respiratory health in Italy and Europe
AIPO Ricerche, Milano
[email protected]
www.aiporicerche.it
October
23-25
Horn
(Netherlands)
Course: “Pulmonary rehabilitation”
[email protected]
www.ersnet.org
October
25-30
Austin, TX
(USA)
Chest 2014
2014.chestmeeting.chestnet.org
www.chestnet.org
October 28 Barcelona
November 1 (Spain)
45th Union World Conference on Lung Health
International Union Against Tuberculos
and Lung Disease, Paris
Tel. +33 144320360
November
7-8
Galatina, LE
(Italy)
Corso: "La riabilitazione respiratoria: dalla teoria alla pratica"
e20covegni, Trani
[email protected]
www.e20econvegni.it
November
5-8
Pisa
(Italy)
XXIV Congresso Nazionale AIMS
[email protected]
www.sonnomed.it
November
18-21
Marseille
(France)
Course: “Thoracoscopy and pleural techniques
[email protected]
www.ersnet.org
November
20-21
Hanover
(Germany)
Course: “Non invasive ventilation: basic concepts”
[email protected]
www.ersnet.org
@
@
XXIV
MRM
MRM volume 9 3-4_Layout 1 29/07/14 11:50 Pagina XXV
Rubrica
WHEN
WHERE
WHAT
WHO TO CONTACT
@
November
20-22
Taormina, ME
(Italy)
Congress: “ Pneumomeeting 2014 – Il confronto interdisciplinare
in Medicina Respiratoria”
SA.MA Service & Congress, Galati Marina (Me)
[email protected]
www.samacongressi.it
@
November Rome
28-29
(Italy)
Convegno:“SPQR: Seminari Pneumologici Quesiti
e Risposte” - III Edizione
@
November
28-29
Lecce
(Italy)
Convegno: “I Incontro Interdisciplinare Salentino
di Medicina Respiratoria – I Workshop Pneumologico Salentino”
Motus Animi, Lecce Tel. +39 0832 521300
www.motusanimi.com
@ ATP November
28-29
Turin
(Italy)
Corso: “La Misura della Funzione Respiratoria”
[email protected]
@
December
4-6
Trani, BT
(Italy)
AIMAR Congress: "Current updates in Respiratory Diseases"
e20covegni, Trani
[email protected]
www.e20econvegni.it
December
4-6
Köln
(Germany)
22nd Annual Meeting of the German Sleep Society
[email protected]
www.dgsm-kongress.de
2015
@
@
February
19-21
Valencia
(Spain)
Congress: “2nd International Workshop on Lung Health, COPD:
New Challenges, New Solutions”
Publi Creations, Monaco
[email protected]
www.publicreations.com
February
19-21
Rome
(Italy)
Course: “Clinical exercise testing”
[email protected]
www.ersnet.org
April 30May 2
Boston, MS
(USA)
American College of Physicians “Internal Medicine Meeting”
www.im20015.acponline.org
May 6-9
Pescara
(Italy)
IV Congresso Nazionale AIMAR-8th International
Conference on Management & Rehabilitation of Chronic
Respiratory Failure
Dynamicom, Milano
[email protected]
www.aimar2015.it
May 15-20
Denver, CO
(USA)
ATS 2015 International Conference
[email protected]
www.thoracic.org
@ = evento AIMAR
@ = evento con patrocinio AIMAR
XXV
MRM
ATP = evento con patrocinio Alleanza per le Malattie Toraco-Polmonari
Riassunto delle caratteristiche del prodotto
1. DENOMINAZIONE DEL MEDICINALE
GIASION 200 mg compresse rivestite con film.
GIASION 400 mg compresse rivestite con film.
2. COMPOSIZIONE QUALITATIVA E QUANTITATIVA
GIASION 200 mg compresse rivestite con film.
Ciascuna compressa rivestita con film contiene 200 mg di cefditoren equivalente a
245,1 mg di cefditoren pivoxil.
GIASION 400 mg compresse rivestite con film.
Ciascuna compressa rivestita con film contiene 400 mg di cefditoren equivalente a
490,2 mg di cefditoren pivoxil.
Per l’elenco completo degli eccipienti, vedere paragrafo 6.1.
3. FORMA FARMACEUTICA
Compresse rivestite con film.
Compresse di forma ellittica di colore bianco con impresso su di un lato il logo “TMF”
di colore blu.
4. INFORMAZIONI CLINICHE
4.1. Indicazioni terapeutiche
GIASION è indicato nel trattamento delle seguenti infezioni causate da microrganismi
sensibili:
(vedere paragrafo 5.1 Proprietà Farmacodinamiche):
s&ARINGOTONSILLITEACUTA
s3INUSITEMASCELLAREACUTA
s%SACERBAZIONEACUTADELLABRONCHITECRONICA
s0OLMONITEACQUISITAINCOMUNITÌDALIEVEAMODERATA
s)NFEZIONINONCOMPLICATEDELLAPELLEEDELLESTRUTTUREDELLAPELLECOMECELLULITEFERITE
infette, ascessi, follicolite, impetigine e foruncoli.
È necessario tenere in considerazione le linee guida ufficiali relative all’utilizzo
appropriato degli agenti antibatterici.
4.2. Posologia e modo di somministrazione
La dose raccomandata dipende dalla gravità dell’infezione, dalla condizione del
paziente e dai microrganismi potenzialmente coinvolti.
Metodo di somministrazione
Le compresse devono essere inghiottite intere con una quantità di acqua sufficiente.
Le compresse devono essere assunte durante i pasti.
Posologia
Adulti e adolescenti (sopra i 12 anni di età)
s&ARINGOTONSILLITEACUTAMGDICEFDITORENOGNIOREPERGIORNI
s3INUSITEMASCELLAREACUTAMGDICEFDITORENOGNIOREPERGIORNI
s%SACERBAZIONEACUTADELLABRONCHITECRONICAMGDICEFDITORENOGNIOREPER
5 giorni
s0OLMONITEACQUISITAINCOMUNITÌ
- In casi lievi: 200 mg di cefditoren ogni 12 ore per 14 giorni
- In casi moderati: 400 mg di cefditoren ogni 12 ore per 14 giorni.
s)NFEZIONINONCOMPLICATEDELLAPELLEEDELLESTRUTTUREDELLAPELLEMGDICEFDITOREN
ogni 12 ore per 10 giorni.
Bambini sotto i 12 anni di età
GIASION non è raccomandato per l’uso nei bambini sotto i 12 anni. L’esperienza nei
bambini è limitata.
Anziani
Negli anziani non è necessario aggiustare la dose se non in caso di grave insufficienza renale e/o epatica.
Insufficienza renale
Non è necessario un aggiustamento della dose per pazienti con insufficienza renale
lieve. In pazienti con insufficienza renale moderata (clearance della creatinina 30-50
ml/min), la dose totale giornaliera non deve superare i 200 mg di cefditoren ogni 12
ore. In pazienti con grave insufficienza renale (clearance della creatinina <30 ml/min)
si raccomanda una singola dose di 200 mg di cefditoren una volta al giorno. La dose
raccomandata non è stata determinata in pazienti sottoposti a dialisi (vedere paragrafi
4.4. Avvertenze speciali e precauzioni di impiego e 5.2 Proprietà farmacocinetiche).
Insufficienza epatica
Non sono necessari aggiustamenti della dose nei pazienti con insufficienza epatica da
lieve (Child-Pugh A) a moderata (Child-Pugh B). In caso di grave insufficienza epatica
(Child-Pugh C) non sono disponibili dati che permettano di stabilire una dose raccomandata (vedere paragrafo 5.2 Proprietà farmacocinetiche).
4.3. Controindicazioni
s )PERSENSIBILITÌ AL PRINCIPIO ATTIVO CEFDITOREN A UNA QUALSIASI ALTRA CEFALOSPORINA O
ad uno qualsiasi degli eccipienti. Per pazienti che sono ipersensibili alla caseina
bisogna sottolineare che il prodotto contiene sodio caseinato.
s0RECEDENTEREAZIONEDIIPERSENSIBILITÌIMMEDIATAEOGRAVEALLAPENICILLINAOADUN
altro tipo di principio attivo beta-lattamico.
s#OMEPERALTRICOMPOSTICHEPRODUCONOPIVALATOCEFDITORENPIVOXILÒCONTROINDICATO
in casi di carenza di carnitina primaria.
4.4. Avvertenze speciali e precauzioni d’impiego
Prima di iniziare la terapia con GIASION, deve essere fatta un’indagine accurata per
determinare se il paziente ha avuto precedenti reazioni di ipersensibilità al cefditoren,
alle cefalosporine, alle penicilline, o ad altri principi attivi beta-lattamici.
Il cefditoren deve essere somministrato con cautela in pazienti che hanno avuto ogni
altro tipo di reazione di ipersensibilità alla penicillina o a un qualsiasi altro principio
attivo beta-lattamico.
Diarrea associata all’uso di antibiotico, colite e colite pseudomembranosa sono state
tutte segnalate associate all’uso di cefditoren. Queste diagnosi devono essere prese
in considerazione in qualsiasi paziente che sviluppa diarrea durante o poco dopo il
trattamento. Il cefditoren deve essere interrotto se durante il trattamento si manifesta
diarrea grave e/o con presenza di sangue e deve essere attuata l’appropriata terapia.
Il cefditoren deve essere usato con cautela in persone con precedenti di malattie
gastrointestinali, in particolare la colite.
In pazienti con insufficienza renale da moderata a grave, la velocità e il grado dell’esposizione al cefditoren è aumentata (vedere paragrafo 5.2 Proprietà farmacocinetiche).
Per questa ragione, la dose totale giornaliera deve essere ridotta quando si somministra cefditoren a pazienti con insufficienza renale acuta o cronica da moderata a grave
per evitare potenziali conseguenze cliniche, come convulsioni (vedere paragrafo 4.2
Posologia e modo di somministrazione).
Le cefalosporine devono essere somministrate con cautela in pazienti che ricevono un
trattamento concomitante con principi attivi nefrotossici come antibiotici aminoglicosidici o diuretici potenti (come la furosemide) dal momento che queste associazioni possono avere effetti indesiderati sulla funzione renale e sono stati associati a ototossicità.
L’uso prolungato di cefditoren può causare una crescita eccessiva di organismi non
sensibili come enterococchi e Candida spp.
Durante il trattamento con cefalosporine si può verificare una diminuzione dell’attività protrombinica. Pertanto in pazienti a rischio come nei pazienti con insufficienza
epatica o renale o pazienti trattati con anticoagulanti, bisogna tenere sotto controllo il
tempo di protrombina.
La somministrazione di profarmaci di tipo pivalato è stata associata a una diminuzione
delle concentrazioni di carnitina nel plasma. Tuttavia gli studi clinici hanno portato a
concludere che alla somministrazione di cefditoren pivoxil non sono stati associati
effetti clinici della diminuzione di carnitina.
GIASION 400 mg compresse rivestite con film contiene 1,14 mmoli (circa 26,2 mg) di
sodio per dose. Questo deve essere tenuto in considerazione dai pazienti sottoposti ad
una dieta con sodio controllato.
4.5. Interazioni con altri medicinali ed altre forme di interazione
Antiacidi
La somministrazione contemporanea di antiacidi contenenti magnesio e alluminio
idrossido e cefditoren pivoxil in presenza di cibo ha provocato una diminuzione della
Cmax e dell’AUC del cefditoren rispettivamente del 14% e dell’11%. Si raccomanda
che vi sia un intervallo di due ore tra la somministrazione di antiacidi e cefditoren
pivoxil.
Antagonisti dei recettori H2
La somministrazione contemporanea di famotidina per via endovenosa e cefditoren
pivoxil per via orale ha provocato una diminuzione della Cmax e dell’AUC del cefditoren
rispettivamente del 27% e del 22%.
Pertanto è sconsigliato l’uso concomitante di cefditoren pivoxil con antagonisti dei
recettori H2.
Probenecid
La somministrazione contemporanea di probenecid e cefditoren pivoxil riduce l’escrezione renale di cefditoren, determinando un aumento del 49% della Cmax, del 122%
dell’AUC e un aumento del 53% dell’emivita di eliminazione.
Contraccettivi orali
La somministrazione di cefditoren pivoxil non ha alterato le proprietà farmacocinetiche del contraccettivo orale etinilestradiolo. Cefditoren pivoxil può essere preso in
concomitanza con contraccettivi orali in associazione contenenti etinilestradiolo.
Interazioni tra medicinali ed esami di laboratorio
s,ECEFALOSPORINEPOSSONODAREUNFALSOPOSITIVONELTESTDI#OOMBSDIRETTOCHEPUÛ
interferire con il test dell’agglutinazione crociata del sangue.
s3IPOSSONOAVEREFALSIPOSITIVIALLESAMEDELGLUCOSIONELLEURINECONILTESTDIRIDUZIOne del rame, ma non nel test enzimatico.
s$ALMOMENTOCHEPOSSONODAREUNRISULTATODIFALSONEGATIVONELTESTDELFERROCIA-
nuro per la determinazione del glucosio nel plasma o nel sangue, in pazienti che
ricevono cefditoren pivoxil si consiglia di utilizzare sia il metodo del glucosio ossidasi
che quello dell’esochinasi per determinare i livelli di glucosio nel plasma/sangue.
4.6. Gravidanza e allattamento
Gravidanza
Gli studi su animali non indicano effetti dannosi diretti o indiretti su gravidanza, sviluppo embrionale/fetale, parto o sviluppo post-natale (vedere 5.3). Non ci sono dati
adeguati dall’uso di cefditoren pivoxil in donne in gravidanza.
Allattamento
Sono disponibili prove insufficienti sulla possibilità della presenza di cefditoren nel
latte materno.
Pertanto si sconsiglia la somministrazione di GIASION durante l’allattamento.
4.7. Effetti sulla capacità di guidare veicoli e sull’uso di macchinari
GIASION ha influenza scarsa o moderata sulla capacità di guidare veicoli e utilizzare macchinari. Il cefditoren pivoxil può causare capogiri e sonnolenza (vedere
paragrafo 4.8).
4.8. Effetti indesiderati
Negli studi clinici circa 6000 pazienti hanno ricevuto cefditoren alla dose sia di 200
mg che 400 mg due volte al giorno per 14 giorni. Circa il 24% dei pazienti ha riportato
almeno una reazione avversa.
Classificazione
per sistemi e organi
Reazioni avverse
molto comuni
(*1/10)
Reazioni avverse
comuni
(*1/100, <1/10)
Esami diagnostici
L’interruzione del trattamento come conseguenza di reazioni avverse si è verificata
nel 2,6% dei pazienti.
I più comuni effetti avversi che si sono verificati erano a carico dell’apparato gastrointestinale.
Nella maggior parte degli studi, la diarrea si è manifestata in più del 10% del totale dei
pazienti e si è manifestata più frequentemente con 400 mg che con 200 mg due volte
al giorno. Le reazioni avverse osservate, evidenziatesi sia durante gli studi clinici sia
l’esperienza post-marketing, sono descritte di seguito:
Entro ciascun gruppo di frequenza, gli effetti indesiderati sono presentati in ordine
decrescente di gravità.
Dato che sono state osservate con altre cefalosporine, possono comparire le seguenti
reazioni avverse: colestasi e anemia aplastica.
Reazioni avverse
non comuni
(*1/1000, <1/100)
Reazioni avverse rare
(*1/10000, <1/1000)
Non nota (la frequenza non può
essere definita sulla base
dei dati disponibili)
Leucopenia,
aumento dell’alanina
aminotransferasi ALT
Allungamento nei tempi
di coagulazione, aumento
dell’aspartato aminotrasferasi AST,
aumentata fosfatasi alcalina,
albuminuria, diminuzione del tempo
di tromboplastina, aumento dell’LDH,
e aumentata creatinina.
Diminuita carnitina serica.
Patologie cardiache
Fibrillazione atriale, insufficienza
cardiaca, sincope, tachicardia,
extrasistole ventricolare
Patologie del sistema
emolinfopoietico
Patologie del sistema
nervoso
Cefalea
Trombocitemia, leucopenia
Eosinofilia, neutropenia,
trombocitopenia,
Anemia emolitica, linfoadenopatia
Nervosismo, capogiri,
insonnia, sonnolenza,
disturbi del sonno
Amnesia, mancanza di coordinazione,
ipertonia, meningite, tremore
Patologie dell’occhio
Ambliopia, disturbi oculari,
dolori oculari, blefarite
Patologie dell’orecchio
e del labirinto
Tinnito
Patologie respiratorie,
toraciche e mediastiniche
Patologie gastrointestinali
Diarrea
Nausea,
dolore addominale,
dispepsia
Faringite, rinite, sinusite
Asma
Costipazione, flatulenza,
vomito, candidosi orale,
eruttazione, bocca secca,
disgeusia
Stomatite, ulcere alla bocca,
colite emorragica, colite ulcerosa,
emorragia gastrointestinale, glossite,
singhiozzo, scolorimento della lingua
Patologie renali e urinarie
Patologie della cute
e del tessuto sottocutaneo
Rash, prurito, orticaria
Patologie del sistema
muscoloscheletrico
e del tessuto connettivo
Disuria, dolore delle cavità renali,
nefrite, nicturia, poliuria,
incontinenza, albuminuria
Insufficienza renale acuta
Acne, alopecia, eczema, dermatite
esfoliativa, herpes simplex,
reazione di fotosensibilità
Sindrome di Stevens Johnson,
eritema multiforme,
necrolisi epidermica tossica
Candidiasi vaginale
Anoressia
Disidratazione, iperglicemia,
ipokaliemia, ipoproteinemia
Infezione fungina
Infezione del tratto urinario,
colite da Clostridium difficile
Patologie vascolari
Patologie sistemiche
e condizioni relative alla
sede di somministrazione
Ipotensione posturale
Febbre, astenia, dolore,
sudorazione
Cattivo odore corporeo, brividi
Disturbi del sistema
immunitario
Patologie epatobiliari
Patologie dell’apparato
riproduttivo
e della mammella
Disturbi psichiatrici
Polmonite eosinofila,
polmonite interstiziale
Mialgia
Disturbi del metabolismo
e della nutrizione
Infezioni ed infestazioni
Agranulocitosi
Shock anafilattico,
malattia da siero
Funzione epatica anormale
Bilirubinemia
Vaginite, leucorrea
Mastalgia, disturbi del ciclo mestruale,
metrorragia, disfunzione erettile
Demenza, spersonalizzazione,
debolezza emotiva, euforia,
allucinazioni, disturbi del pensiero,
aumento della libido
Danno epatico, epatiti
4.9. Sovradosaggio
Non è stato riportato alcun caso di sovradosaggio.
I sintomi di sovradosaggio riportati per altre cefalosporine sono irritazione cerebrale
che porta convulsioni. In caso di sovradosaggio, bisogna attuare una lavanda gastrica.
Il paziente deve essere strettamente monitorato e deve essere trattato con un corretto
trattamento sintomatico e di supporto.
Il cefditoren pivoxil può essere parzialmente eliminato attraverso l’emodialisi.
5. PROPRIETÀ FARMACOLOGICHE
5.1. Proprietà farmacodinamiche
Categoria farmacoterapeutica
Medicinale
sottoposto
a monitoraggio
addizionale.
Cefalosporine
di terza
generazione,
codice ATC:
J01DD16Ciò permetterà la rapida identificazionedidiazione
nuove informazioni sulla sicurezza. Agli operatori sanitari è richiesto di
Meccanismo
segnalare
qualsiasi
reazione
avversa
sospetta.
Vedere laparagrafo
4.8 per
informazioni
Il cefditoren
esercita
la sua
azione
antibatterica
inibendo
sintesi della
parete
cellulasulle modalità
segnalazione
avverse.
re batterica
graziedialla
sua affinitàdelle
per reazioni
le proteine
che legano la penicillina (PBPs).
Relazioni farmacocinetiche/farmacodinamiche
Con una dose di 200 mg due volte al giorno, le concentrazioni plasmatiche superano
1. DENOMINAZIONE
MEDICINALE
la concentrazione
minimaDEL
inibente
(MIC90) di Moraxella catarrhalis, Haemophilus influenzae,
Streptococcus
pyogenes
e ceppi
di Streptococcus
sensibile alla
Tovanor
Breezhaler 44
microgrammi
polvere
per inalazione,pneumoniae
capsule rigide.
penicillina per almeno il 50% dell’intervallo fra le somministrazioni.
La dose
di 400 mg due QUALITATIVA
volte al giorno,
determina inoltre un tempo al di sopra della
2. COMPOSIZIONE
E QUANTITATIVA
concentrazione
minima
inibente
è sufficiente
per superare
la MICequivalenti
Ciascuna capsula
contiene
63 che
microgrammi
di glicopirronio
bromuro,
a 50
90 dello Streptococcus
pneumoniae
resistenteCiascuna
alla penicillina.
microgrammi
di glicopirronio.
dose erogata (la dose rilasciata dal boccaglio
Meccanismi
di resistenza
dell’inalatore)
contiene 55 microgrammi di glicopirronio bromuro, equivalenti a 44 miLa resistenza
batterica
al cefditoren
può essere dovuta
a unonoti:
o piùciascuna
dei seguenti
meccanismi:
crogrammi
di glicopirronio.
Eccipiente(i)
con effetti
capsula
contiene
s)DROLISIDAPARTEDIBETALATTAMASI)LCEFDITORENPUÛESSEREEFlCACEMENTEIDROLIZZATO
23,6 mg di lattosio (come monoidrato).
daPer
alcune
beta-lattamasi
adeccipienti,
ampio spettro
e 6.1.
da enzimi codificati cromol’elenco
completo degli
vedere(ESBLs)
paragrafo
somicamente (famiglia AmpC) che in alcune specie di batteri aerobi gram-negativi
possono
essere
indotti o stabilmente non espressi.
3. FORMA
FARMACEUTICA
s2IDOTTAAFlNITÌDELCEFDITORENPERLEPROTEINECHELEGANOLAPENICILLINA
Polvere per inalazione, capsula rigida. Capsule trasparenti di colore arancione contes )MPERMEABILITÌ
DELLA
MEMBRANA
CHEeLIMITA
LACCESSO
DEL CEFDITOREN
ALLE
nenti una polvere
bianca,
con unaESTERNA
banda nera
il codice
del prodotto
“GPL50” stamproteine
penicillina
negli
organismi
pato inche
nerolegano
sopra lala banda
e il logo
aziendale
( ) gram-negativi.
stampato in nero sotto la banda.
s0OMPEDIEFmUSSODELPRINCIPIOATTIVO
Più di4.uno
di questi meccanismi
di resistenza può coesistere in una singola cellula batINFORMAZIONI
CLINICHE
terica.
base al/ai meccanismo/i
i batteri possono
dare
resistenza
crociata
4.1InIndicazioni
terapeutiche.presente/i,
Tovanor Breezhaler
è indicato
come
terapia broncodiad alcuni
o tutti
gli altri principi
beta-lattamici
antibatterici
altre famiglie.
latatrice
di mantenimento
perattivi
alleviare
i sintomi ine/o
pazienti
adulti condibroncopneumopaI microrganismi
gram-negativi
che
producono
beta-lattamasi
inducibili codificate
tia cronica ostruttiva
(BPCO). 4.2
Posologia
e modo
di somministrazione.
Posologia.
cromosomicamente,
comeèEnterobacter
Serrantia
spp.,
Citrobacter
spp.
ProLa dose raccomandata
l’inalazione delspp.,
contenuto
di una
capsula
una volta
al egiorno,
videntia
spp.,
dovrebbero
essere
considerati
resistenti
al
cefditoren
malgrado
l’apusando l’inalatore Tovanor Breezhaler. Si raccomanda la somministrazione di Tovanor
parente
suscettibilità
in vitro.
Breezhaler
ogni giorno,
alla stessa ora. Se è stata dimenticata una dose, la dose sucLimiticessiva
di suscettibilità
deve essere presa il più presto possibile. I pazienti devono essere istruiti a non
I valori
limite
di
MIC
raccomandati
per Popolazioni
il cefditoren speciali.
che permettono
distinguere
i miassumere più di una dose al giorno.
Anziani.diTovanor
Breezhaler
crorganismi
sensibili
che hanno
sensibilità
intermedia,
e i omicrorganipuò essere
usatoda
allamicrorganismi
dose raccomandata
nei pazienti
anziani
(età uguale
superiore a
smi con
sensibilità
intermedia
microrganismi
resistenti
sono:Alla
sensibile
)0,5 μg/ml,
75 anni)
(vedere
paragrafodai
4.8).
Compromissione
renale.
dose raccomandata
resistente
*2Breezhaler
μg/ml (o >1
criteri
recenti).
Tovanor
puòμg/ml
esseresecondo
usato nei
pazienti
con compromissione renale da lieve a
La prevalenza di resistenza acquisita può variare geograficamente e con il tempo per
moderata.
Nei ed
pazienti
con grave
compromissione
o malattia
renaleinallo
stadio
specie
selezionate
è preferibile
avere
informazioni renale
locali sulla
resistenza,
particoterminalesi che
richiede
dialisigravi.
Tovanor
Breezhaler deve
essereessere
usato chiesto
solo se consiglio
i benefici
lare quando
trattano
infezioni
Se necessario,
dovrebbe
attesi superano
i rischi
potenziali
(vedere
paragrafi locale
4.4 e 5.2).
epaagli esperti
quando la
grande
diffusione
di resistenza
è taleCompromissione
da rendere di dubbia
sono statiincondotti
neitipi
pazienti
con compromissione epatica. Il glicopirutilitàtica.
l’usoNon
dell’agente
almenostudi
alcuni
di infezioni.
ronio è eliminato prevalentemente mediante escrezione renale e non si prevede pertanto una maggiore esposizione nei pazienti con compromissione epatica. Popolazione
Specie
comunemente
pediatrica.
Non esiste sensibili
alcuna indicazione per un uso specifico di Tovanor Breezhaler
nella
BPCO
nella
popolazione pediatrica (età inferiore a 18 anni). Modo di somminiBatteri aerobi Gram-positivi:
strazione. Esclusivamente
per uso inalatorio. Le capsule devono essere somministrate
Streptococchi
CeG
utilizzando esclusivamente
l’inalatore
Tovanor Breezhaler
(vedere paragrafo 6.6). Le
Staphylococcus
aureus sensibile
alla meticillina
*
capsule non devono
essere ingerite. I pazienti devono essere istruiti su come assumere
Streptococcus
agalactiae
$ le istruzioni sull’uso del medicinale prima della sommicorrettamentepneumoniae
il medicinale. *Per
Streptococcus
nistrazione, vedere
paragrafo
Streptococcus
pyogenes
* 6.6. 4.3 Controindicazioni. Ipersensibilità al principio
attivo o ad uno qualsiasi degli eccipienti elencati al paragrafo 6.1. 4.4 Avvertenze
Batteri
aerobi
Gram-negativi:
speciali
e precauzioni
di impiego. Non deve essere usato negli episodi acuti.
Tovanor Breezhaler
è una* terapia di mantenimento a lungo termine, in monosomminiHaemophilus
influenzae
Moraxella
strazionecatarrhalis
giornaliera e* non è indicato nel trattamento iniziale degli episodi acuti di broncospasmo, cioè come terapia di soccorso. Broncospasmo paradosso. Negli studi
Batteri
anaerobi:
clinici con Tovanor Breezhaler non è stato osservato broncospasmo paradosso. Il bronClostridium
cospasmo perfringes
paradosso è stato tuttavia osservato con altre terapie inalatorie e può essere
Peptostreptococcus
spp.
pericoloso per la vita.
Se questo succede, Tovanor Breezhaler deve essere sospeso immediatamente
e
deve
essereintrinseca
istituita una terapia alternativa. Effetto anticolinergico.
Organismi con resistenza
Tovanor Breezhaler deve essere usato con cautela nei pazienti con glaucoma ad angolo
Batteri
strettoaerobi
o con Gram-positivi:
ritenzione urinaria. I pazienti devono essere informati sui segni e i sintomi
del glaucomaspp.
acuto ad angolo chiuso e devono essere informati di interrompere l’uso di
Enterococcus
Tovanor Breezhaler
e rivolgersi
immediatamente
al medico
se+ si manifesta uno qualsiaStaphylococcus
aureus
resistente
alla meticillina
(MRSA)
si di questi segni o sintomi. Pazienti con grave compromissione renale. È stato osBatteri
aerobi
Gram-negativi:
servato
un moderato
aumento medio dell’esposizione totale sistemica (AUClast), fino a
Acinetobacter
1,4 volte, nei baumanii
soggetti con compromissione renale lieve e moderata e un aumento fino a
Pseudomonas
aeruginosa
2,2 volte nei soggetti
con grave compromissione renale e con malattia renale allo stadio
terminale.
Nei pazienti con grave compromissione renale (velocità di filtrazione glomeBatteri
anaerobi:
rulare calcolata inferiore a 30 ml/min/1,73 m2), compresi quelli con malattia renale allo
Bacteroides
fragilis
stadio terminale
che richiede dialisi, Tovanor Breezhaler deve essere utilizzato solo se il
Clostridium
difficile
beneficio atteso
supera il rischio potenziale (vedere paragrafo 5.2). Questi pazienti devono essere strettamente controllati per potenziali reazioni avverse. Pazienti con stoAltri:
ria di malattia
Chlamydia
spp. cardiovascolare. Pazienti con cardiopatia ischemica instabile, insufficienza ventricolare sinistra, storia d’infarto miocardico, aritmia (eccetto la fibrillazione
Mycoplasma
atriale cronica
Legionella
spp. stabile), storia di sindrome del QT lungo o il cui QTc (metodo Fridericia)
era prolungato (>450 ms per gli uomini o >470 ms per le donne) sono stati esclusi
+
daglihanno
studi acquisito
clinici e pertanto
l’esperienza
in questi gruppi
di pazienti
è limitata.
Tovanor
MRSA
resistenza
alle cefalosporine
ma sono
inclusi qui
per comodità
Breezhaler
deve essere
con cautela
questi gruppi disensibili
pazienti.nelle
Eccipienti.
I pa* L’efficacia
clinica
è statausato
dimostrata
per in
microrganismi
indicazioni
zienti approvate.
affetti da rari problemi ereditari di intolleranza al galattosio, da deficit di Lapp
cliniche
$
lattasi
o dache
malassorbimento
di glucosio-galattosio
nonalla
devono
assumere
questomomeAlcuni
ceppi
mostrano un alto
livello di resistenza
penicillina
possono
dicinale.
Interazioni
con altri
medicinali Ied
altreresistenti
forme di interazione.
strare
una 4.5
diminuita
sensibilità
al cefditoren.
ceppi
a cefotaximaLae somcefministrazione
contemporanea
di Tovanorsensibili.
Breezhaler con altri medicinali anticolinergici
triaxone
non devono
essere considerati
non è stata studiata e non è pertanto raccomandata. In uno studio clinico in volontari
sani, la cimetidina, un inibitore del trasporto di cationi organici che si ritiene possa
contribuire all’escrezione renale del glicopirronio, ha aumentato del 22% l’esposizione
RIASSUNTO
5.2. Proprietà farmacocinetiche
Assorbimento
DELLE
CARATTERISTICHE
DEL
PRODOTTO
In seguito
a somministrazione
orale, il cefditoren
pivoxil
è assorbito nel tratto gastrointestinale ed è idrolizzato a cefditoren per azione delle esterasi. La biodisponibilità assoluta del cefditoren somministrato per via orale è circa del 15-20%.
La presenza di cibo nel tratto gastrointestinale aumenta l’assorbimento del cefditoren pivoxil, con la Cmax e l’AUC circa il 50% e il 70% più elevati rispetto ai valori
misurati a digiuno.
Una dose di 200 mg somministrata con il cibo determina una Cmax media di 2,6 μg/ml
dopo circa 2,5 ore, mentre una dose di 400 mg dà un valore medio della Cmax di
totale
(AUC)all’incirca
al glicopirronio
diminuito
del 23%
la clearance renale. In base alla gran4,1 μg/ml,
nelloestesso
periodo
di tempo.
dezza
di queste modifiche, non si prevede un’interazione clinicamente rilevante quando
Distribuzione
ilIl glicopirronio
somministrato
insieme
a cimetidina
altri inibitori del trasporto dei
cefditoren siè lega
alle proteine
plasmatiche
perol’88%.
cationi
organici.
La somministrazione
Tovanor
Breezhaler e indacateroIl volume
di distribuzione
allo statoconcomitante
stazionariodinon
è significativamente
diverso da
lo
per inalazione
condizioni
di stato
quello
calcolatoorale,
dopounlabeta
somministrazione
di unainsingola
dose
ed è stazionario
relativamente
2-agonista adrenergico,
indipendente
dalla dose
somministrata
- 65 litri).
per
entrambi i principi
attivi non
ha influenzato(40
la farmacocinetica
di entrambi i medicinali.
In seguito
alla
somministrazione
di una Gravidanza.
dose singolaI dati
di 400
mg,
la penetrazione
4.6
Fertilità,
gravidanza
e allattamento.
relativi
all’uso
di Tovanella
mucosainbronchiale
e nelle secrezioni
bronchiali
è stata
rispettivamente
nor
Breezhaler
donne in gravidanza
non esistono.
Gli studi sugli
animali
non indicano del
60% edannosi
del 20%
della
concentrazione
Dopo la
stessa 5.3).
doseDurante
le conceneffetti
diretti
o indiretti
di tossicità plasmatica.
riproduttiva (vedere
paragrafo
trazioni
di cefditoren
nel deve
fluidoessere
delleusato
bollesolo
cutanee
raggiungono
il 40%
e il 56%
la
gravidanza
il glicopirronio
se il beneficio
atteso per
la paziendell’AUC
8 e 12 ore.
te
giustificaplasmatica
il potenzialerispettivamente
rischio per il feto.dopo
Allattamento.
Non è noto se il glicopirronio
Metabolismo/eliminazione
bromuro
sia escreto nel latte materno. Tuttavia, il glicopirronio bromuro (compresi i suoi
In seguitoèastato
somministrazione
doseratte
multipla,
i parametri
farmacocinetici
metaboliti)
escreto nel lattedidelle
in allattamento
(vedere
paragrafo 5.3).sono
risultati
simili a quelli
ottenuti
la somministrazione
di unasolo
dose
senza
L’uso del glicopirronio
in donne
chedopo
allattano
deve essere considerato
se singola,
il beneficio
che sia
osservato
accumulo.
atteso
perstato
la donna
è superiore
a ogni possibile rischio per il lattante (vedere paragrafo
Fino Fertilità.
al 18% della
somministrata
di dati
cefditoren
si recupera
attraverso
l’escre5.3).
Studi dose
sulla riproduzione
e altri
sugli animali
non segnalano
preoccuzione urinaria
senza sia
essere
metabolizzato.
pazioni
per la fertilità
maschile
sia femminile (vedere paragrafo 5.3). 4.7 Effetti
L’emivita
di eliminazione
del cefditoren
è 1-1,5Ilore.
La clearance
sulla
capacità
di guidare plasmatica
veicoli e sull’uso
di macchinari.
glicopirronio
non al-totale
aggiustata
biodisponibilità
è didicirca
25-30
l/h,o mentre
clearance retera
o altera rispetto
in modo alla
trascurabile
la capacità
guidare
veicoli
di usarelamacchinari.
nale è di circa 80-90 ml/min. Studi con il cefditoren marcato in volontari sani sug4.8
Effetti che
indesiderati.
del profilo
di sicurezza.
La reazione
geriscono
la frazioneRiassunto
non assorbita
è eliminata
nelle feci,
mentre avversa
la maggior
anticolinergica
più comune
è stata la secchezza
bocca
(2,4%). Le
segnalazioni
di
parte del cefditoren
somministrato
comparedella
come
metaboliti
inattivi.
Il cefditoren
secchezza
della
bocca
sono
state
per
la
maggior
parte
di
lieve
entità,
nessuna
grave,
e
pivoxil non è rilevato né nelle feci né nell’urina. La porzione di pivalato è eliminata
siattraverso
sospetta che
siano correlate
al medicinale.
Il profilo di sicurezza
è ulteriormente cal’escrezione
renale,
come pivaloilcarnitina
coniugato.
ratterizzato
altri sintomi correlati agli effetti anticolinergici, compresi segni di ritenPopolazionidaspeciali
zione
Sessourinaria, che sono stati non comuni. Sono stati anche osservati effetti gastrointestinali,
comprendenti del
gastroenterite
dispepsia.
Le reazioni
avverse indifferenze
termini dicliniLa farmacocinetica
cefditoren epivoxil
non mostra
significative
tollerabilità
localeecomprendono
che tra maschi
femmine. irritazione della gola, nasofaringite, rinite e sinusite.
Tabella
Anziani delle reazioni avverse. Le reazioni avverse riportate durante i primi sei mesi
di
due studi
principalidiraggruppati
fasesoggetti
III della durata
6 e 12 mesi
I livelli
plasmatici
cefditorendinei
anzianidi (sopra
i 65 sono
anni elencate
di età) mosecondo
MedDRA per sistemi
e organi
(Tabella
1). All’interno
di soggetti
ciadi circa
il 26%
e il 33%
più alte dei
strano lalaCclassificazione
max e l’AUC rispettivamente
scuna
per organo,
le reazioni
avverse
sono state
classificate in base
alladose
frequenadulticlasse
più giovani.
Comunque
non
è necessario
l’aggiustamento
della
eccetto
za,
più frequenti
elencate
per prime.
All’interno
di ciascun gruppo di
nei con
casiledireazioni
insufficienza
epatica
e/o renale
in stadio
avanzato.
frequenza,
le reazioni
Insufficienza
renale avverse sono riportate in ordine di gravità decrescente. Inoltre,
Dopo
la somministrazione
ripetute di categoria
cefditorendi pivoxil
400simg
pazienti
per
ciascuna
reazione avversa,diladosi
corrispondente
frequenza
basainsulla
con insufficienza
renale
moderata
a severa,
valore di<1/10);
Cmax è non
stato
due volte
seguente
convenzione:
moltodacomune
(≥1/10);
comuneil (≥1/100,
comune
e quello dell’AUC
a 3 volte <1/1000);
quello osservato
in volontari
saninon
(vedere
(≥1/1000,
<1/100); da
raro2,5
(≥1/10.000,
molto raro
(<1/10.000);
nota (laparagrafo 4.2non
Posologia
e modo
di sulla
somministrazione).
Non ci sono dati disponibili per
frequenza
può essere
definita
base dei dati disponibili).
pazienti sottoposti a dialisi.
Insufficienza
epatica
Tabella
1. Reazioni
avverse segnalate nella banca dati raggruppata a 6 mesi.
Nell’insufficienza epatica da lieve (Child-Pugh A) a moderata (Child-Pugh B) dosi
Reazionidi avverse
ripetute
cefditoren pivoxil 400 mg hannoFrequenza
dato un leggero aumento dei parametri
farmacocinetici, confrontati con quelli di soggetti normali. Non sono disponibili dati
Infezioni
ed
infestazioni
in pazienti con grave insufficienza epatica (Child-Pugh C) (vedere paragrafo 4.2
Posologia
e 1Modo di somministrazione). Comune
Nasofaringite
5.3. Dati preclinici di sicurezza
I Rinite
dati non clinici non rilevano particolare rischio
per l’uomo in base agli studi conNon comune
venzionali di farmacologia, tossicità a dose ripetuta, genotossicità e tossicità della
Cistite
Non comune
riproduzione.
Non
sonodel
stati
eseguiti studi
per nutrizione
valutare il potenziale carcinogeno di cefditoren
Disturbi
metabolismo
e della
pivoxil.
6.Iperglicemia
INFORMAZIONI FARMACEUTICHE
Non comune
6.1. Elenco degli eccipienti
Disturbi psichiatrici
Nucleo:
Sodio caseinato
Insonnia
Comune
Croscarmellosa sodica
Mannitolo
E421
Patologie del sistema nervoso
Sodio tripolifosfato
Cefalea2 stearato
Comune
Magnesio
Rivestimento della compressa:
Ipoestesia
Opadry
Y-1-7000 contenente: IpromellosaNon comune
Titanio biossido E 171
Patologie cardiache
Macrogol 400
Cera
carnauba
Fibrillazione
atriale
Non comune
Inchiostro OPACODE S-1-20986 blu contenente:
Palpitazioni
Non comune
Shellac
Lacca
blu brillante
Patologie
respiratorie, toraciche e mediastiniche
Titanio biossido E 171
Congestione
dei seni nasali
Non comune
Glicol
propilenico
Soluzione concentrata di ammoniaca
Tosse
produttiva
Non comune
6.2. Incompatibilità
Non
pertinente
Irritazione
della gola
Non comune
6.3. Periodo di validità
Epistassi 200 mg compresse rivestite con film:
Non comune
GIASION
3 anni.
GIASION 400 mg compresse rivestite con film: 2 anni.
Patologie
gastrointestinali
6.4. Precauzioni particolari per la conservazione
Non
conservare
a temperatura superiore aComune
30°C. Conservare nella confezione oriSecchezza
della bocca
ginale.
Gastroenterite
Comune
Dispepsia
Non comune
Carie dentali
Non comune
6.5. Natura e contenuto del contenitore
Blister perforati per ciascuna dose con copertura di alluminio/polivinilcloruro (PVC) e
PVC/alluminio/PA laminato.
Una confezione di GIASION 200 mg contiene 16, 20 o 500 compresse rivestite con film.
Una confezione di GIASION 400 mg contiene 10 o 500 compresse rivestite con film.
E’ possibile che non tutte le confezioni siano commercializzate.
6.6. Precauzioni particolari per lo smaltimento
Nessuna istruzione particolare.
7. TITOLARE DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO
ZAMBON ITALIA s.r.l.
Via Lillo del Duca 10
20091 BRESSO (MI)
8. NUMERO/I DELL’AUTORIZZAZIONE/I ALL’IMMISSIONE IN COMMERCIO
200 mg compresse rivestite con film 16 compresse – AIC n. 037146014
200 mg compresse rivestite con film 20 compresse – AIC n. 037146026
200 mg compresse rivestite con film 500 compresse – AIC n. 037146038
400 mg compresse rivestite con film 10 compresse – AIC n. 037146040
400 mg compresse rivestite con film 500 compresse – AIC n. 037146053
9. DATA DELLA PRIMA AUTORIZZAZIONE/ RINNOVO DELL’AUTORIZZAZIONE
Prima autorizzazione: 13 novembre 2007
Rinnovo: 22 marzo 2009
10. DATA DI REVISIONE DEL TESTO
13 giugno 2012
Informazioni fornite ai sensi del Decreto Legislativo n. 219, Art 119, comma 3:
Medicinale soggetto a prescrizione medica Classe A
° GIASION 200 mg compresse rivestite con film 16 compresse
- non commercializzato
° GIASION 200 mg compresse rivestite con film 20 compresse
- euro 35,75
° GIASION 200 mg compresse rivestite con film 500 compresse
- non commercializzato
° GIASION 400 mg compresse rivestite con film 10 compresse
- euro 35,75
° GIASION 400 mg compresse rivestite con film 500 compresse
- non commercializzato
300812
!
"
%&'"(
!"
#$
!"
#
#
"
!!
$
#%"
%
!&!
$
!
! ! !!
'
!"
!! ! ! ! !
!
!
#!
!!
&
!#"
!
!!"!!
!
!
! ())* ' !
!!+
!$&
!""!
#!"
!
,'
!
!
!%
#%
&
!
!
!
-%
!
!
!
#%
!
!
'%
!
.! !
!
!
!%
&
, % !
!
! !
,
#&
%%
#/
#
!
0
#
!
!
1 ,"!
#2)"(
!(
"*(+,-.(/,0(
1
1 3!
"42
!
1 3!
+42
!
1 3!
"!
1 % !
0*1"1
3
1 ,
%-
#
1
1
1
1
1
1
1
1
2"
!
!
22"
,"
!
!2
,!
"
,
/
"
!%
!
"4
RIASSUNTO
DELLE CARATTERISTICHE DEL PRODOTTO
Medicinale sottoposto a monitoraggio addizionale. Ciò permetterà la rapida identificazione di nuove informazioni sulla sicurezza. Agli operatori sanitari è richiesto di
segnalare qualsiasi reazione avversa sospetta. Vedere paragrafo 4.8 per informazioni
sulle modalità di segnalazione delle reazioni avverse.
1. DENOMINAZIONE DEL MEDICINALE
Tovanor Breezhaler 44 microgrammi polvere per inalazione, capsule rigide.
2. COMPOSIZIONE QUALITATIVA E QUANTITATIVA
Ciascuna capsula contiene 63 microgrammi di glicopirronio bromuro, equivalenti a 50
microgrammi di glicopirronio. Ciascuna dose erogata (la dose rilasciata dal boccaglio
dell’inalatore) contiene 55 microgrammi di glicopirronio bromuro, equivalenti a 44 microgrammi di glicopirronio. Eccipiente(i) con effetti noti: ciascuna capsula contiene
23,6 mg di lattosio (come monoidrato).
Per l’elenco completo degli eccipienti, vedere paragrafo 6.1.
3. FORMA FARMACEUTICA
Polvere per inalazione, capsula rigida. Capsule trasparenti di colore arancione contenenti una polvere bianca, con una banda nera e il codice del prodotto “GPL50” stampato in nero sopra la banda e il logo aziendale ( ) stampato in nero sotto la banda.
4. INFORMAZIONI CLINICHE
4.1 Indicazioni terapeutiche. Tovanor Breezhaler è indicato come terapia broncodilatatrice di mantenimento per alleviare i sintomi in pazienti adulti con broncopneumopatia cronica ostruttiva (BPCO). 4.2 Posologia e modo di somministrazione. Posologia.
La dose raccomandata è l’inalazione del contenuto di una capsula una volta al giorno,
usando l’inalatore Tovanor Breezhaler. Si raccomanda la somministrazione di Tovanor
Breezhaler ogni giorno, alla stessa ora. Se è stata dimenticata una dose, la dose successiva deve essere presa il più presto possibile. I pazienti devono essere istruiti a non
assumere più di una dose al giorno. Popolazioni speciali. Anziani. Tovanor Breezhaler
può essere usato alla dose raccomandata nei pazienti anziani (età uguale o superiore a
75 anni) (vedere paragrafo 4.8). Compromissione renale. Alla dose raccomandata
Tovanor Breezhaler può essere usato nei pazienti con compromissione renale da lieve a
moderata. Nei pazienti con grave compromissione renale o malattia renale allo stadio
terminale che richiede dialisi Tovanor Breezhaler deve essere usato solo se i benefici
attesi superano i rischi potenziali (vedere paragrafi 4.4 e 5.2). Compromissione epatica. Non sono stati condotti studi nei pazienti con compromissione epatica. Il glicopirronio è eliminato prevalentemente mediante escrezione renale e non si prevede pertanto una maggiore esposizione nei pazienti con compromissione epatica. Popolazione
pediatrica. Non esiste alcuna indicazione per un uso specifico di Tovanor Breezhaler
nella BPCO nella popolazione pediatrica (età inferiore a 18 anni). Modo di somministrazione. Esclusivamente per uso inalatorio. Le capsule devono essere somministrate
utilizzando esclusivamente l’inalatore Tovanor Breezhaler (vedere paragrafo 6.6). Le
capsule non devono essere ingerite. I pazienti devono essere istruiti su come assumere
correttamente il medicinale. Per le istruzioni sull’uso del medicinale prima della somministrazione, vedere paragrafo 6.6. 4.3 Controindicazioni. Ipersensibilità al principio
attivo o ad uno qualsiasi degli eccipienti elencati al paragrafo 6.1. 4.4 Avvertenze
speciali e precauzioni di impiego. Non deve essere usato negli episodi acuti.
Tovanor Breezhaler è una terapia di mantenimento a lungo termine, in monosomministrazione giornaliera e non è indicato nel trattamento iniziale degli episodi acuti di broncospasmo, cioè come terapia di soccorso. Broncospasmo paradosso. Negli studi
clinici con Tovanor Breezhaler non è stato osservato broncospasmo paradosso. Il broncospasmo paradosso è stato tuttavia osservato con altre terapie inalatorie e può essere
pericoloso per la vita. Se questo succede, Tovanor Breezhaler deve essere sospeso immediatamente e deve essere istituita una terapia alternativa. Effetto anticolinergico.
Tovanor Breezhaler deve essere usato con cautela nei pazienti con glaucoma ad angolo
stretto o con ritenzione urinaria. I pazienti devono essere informati sui segni e i sintomi
del glaucoma acuto ad angolo chiuso e devono essere informati di interrompere l’uso di
Tovanor Breezhaler e rivolgersi immediatamente al medico se si manifesta uno qualsiasi di questi segni o sintomi. Pazienti con grave compromissione renale. È stato osservato un moderato aumento medio dell’esposizione totale sistemica (AUClast), fino a
1,4 volte, nei soggetti con compromissione renale lieve e moderata e un aumento fino a
2,2 volte nei soggetti con grave compromissione renale e con malattia renale allo stadio
terminale. Nei pazienti con grave compromissione renale (velocità di filtrazione glomerulare calcolata inferiore a 30 ml/min/1,73 m2), compresi quelli con malattia renale allo
stadio terminale che richiede dialisi, Tovanor Breezhaler deve essere utilizzato solo se il
beneficio atteso supera il rischio potenziale (vedere paragrafo 5.2). Questi pazienti devono essere strettamente controllati per potenziali reazioni avverse. Pazienti con storia di malattia cardiovascolare. Pazienti con cardiopatia ischemica instabile, insufficienza ventricolare sinistra, storia d’infarto miocardico, aritmia (eccetto la fibrillazione
atriale cronica stabile), storia di sindrome del QT lungo o il cui QTc (metodo Fridericia)
era prolungato (>450 ms per gli uomini o >470 ms per le donne) sono stati esclusi
dagli studi clinici e pertanto l’esperienza in questi gruppi di pazienti è limitata. Tovanor
Breezhaler deve essere usato con cautela in questi gruppi di pazienti. Eccipienti. I pazienti affetti da rari problemi ereditari di intolleranza al galattosio, da deficit di Lapp
lattasi o da malassorbimento di glucosio-galattosio non devono assumere questo medicinale. 4.5 Interazioni con altri medicinali ed altre forme di interazione. La somministrazione contemporanea di Tovanor Breezhaler con altri medicinali anticolinergici
non è stata studiata e non è pertanto raccomandata. In uno studio clinico in volontari
sani, la cimetidina, un inibitore del trasporto di cationi organici che si ritiene possa
contribuire all’escrezione renale del glicopirronio, ha aumentato del 22% l’esposizione
totale (AUC) al glicopirronio e diminuito del 23% la clearance renale. In base alla grandezza di queste modifiche, non si prevede un’interazione clinicamente rilevante quando
il glicopirronio è somministrato insieme a cimetidina o altri inibitori del trasporto dei
cationi organici. La somministrazione concomitante di Tovanor Breezhaler e indacaterolo per inalazione orale, un beta2-agonista adrenergico, in condizioni di stato stazionario
per entrambi i principi attivi non ha influenzato la farmacocinetica di entrambi i medicinali.
4.6 Fertilità, gravidanza e allattamento. Gravidanza. I dati relativi all’uso di Tovanor Breezhaler in donne in gravidanza non esistono. Gli studi sugli animali non indicano
effetti dannosi diretti o indiretti di tossicità riproduttiva (vedere paragrafo 5.3). Durante
la gravidanza il glicopirronio deve essere usato solo se il beneficio atteso per la paziente giustifica il potenziale rischio per il feto. Allattamento. Non è noto se il glicopirronio
bromuro sia escreto nel latte materno. Tuttavia, il glicopirronio bromuro (compresi i suoi
metaboliti) è stato escreto nel latte delle ratte in allattamento (vedere paragrafo 5.3).
L’uso del glicopirronio in donne che allattano deve essere considerato solo se il beneficio
atteso per la donna è superiore a ogni possibile rischio per il lattante (vedere paragrafo
5.3). Fertilità. Studi sulla riproduzione e altri dati sugli animali non segnalano preoccupazioni per la fertilità sia maschile sia femminile (vedere paragrafo 5.3). 4.7 Effetti
sulla capacità di guidare veicoli e sull’uso di macchinari. Il glicopirronio non altera o altera in modo trascurabile la capacità di guidare veicoli o di usare macchinari.
4.8 Effetti indesiderati. Riassunto del profilo di sicurezza. La reazione avversa
anticolinergica più comune è stata la secchezza della bocca (2,4%). Le segnalazioni di
secchezza della bocca sono state per la maggior parte di lieve entità, nessuna grave, e
si sospetta che siano correlate al medicinale. Il profilo di sicurezza è ulteriormente caratterizzato da altri sintomi correlati agli effetti anticolinergici, compresi segni di ritenzione urinaria, che sono stati non comuni. Sono stati anche osservati effetti gastrointestinali, comprendenti gastroenterite e dispepsia. Le reazioni avverse in termini di
tollerabilità locale comprendono irritazione della gola, nasofaringite, rinite e sinusite.
Tabella delle reazioni avverse. Le reazioni avverse riportate durante i primi sei mesi
di due studi principali raggruppati di fase III della durata di 6 e 12 mesi sono elencate
secondo la classificazione MedDRA per sistemi e organi (Tabella 1). All’interno di ciascuna classe per organo, le reazioni avverse sono state classificate in base alla frequenza, con le reazioni più frequenti elencate per prime. All’interno di ciascun gruppo di
frequenza, le reazioni avverse sono riportate in ordine di gravità decrescente. Inoltre,
per ciascuna reazione avversa, la corrispondente categoria di frequenza si basa sulla
seguente convenzione: molto comune (≥1/10); comune (≥1/100, <1/10); non comune
(≥1/1000, <1/100); raro (≥1/10.000, <1/1000); molto raro (<1/10.000); non nota (la
frequenza non può essere definita sulla base dei dati disponibili).
Tabella 1. Reazioni avverse segnalate nella banca dati raggruppata a 6 mesi.
Reazioni avverse
Frequenza
Infezioni ed infestazioni
Nasofaringite1
Comune
Rinite
Non comune
Cistite
Non comune
Disturbi del metabolismo e della nutrizione
Iperglicemia
Non comune
Disturbi psichiatrici
Insonnia
Comune
Patologie del sistema nervoso
Cefalea2
Comune
Ipoestesia
Non comune
Patologie cardiache
Fibrillazione atriale
Non comune
Palpitazioni
Non comune
Patologie respiratorie, toraciche e mediastiniche
Congestione dei seni nasali
Non comune
Tosse produttiva
Non comune
Irritazione della gola
Non comune
Epistassi
Non comune
Patologie gastrointestinali
Secchezza della bocca
Comune
Gastroenterite
Comune
Dispepsia
Non comune
Carie dentali
Non comune
Patologie della cute e del tessuto sottocutaneo
Eruzione cutanea
Non comune
Patologie del sistema muscoloscheletrico e del tessuto connettivo
Dolore agli arti
Non comune
Dolore muscoloscheletrico toracico
Non comune
Patologie renali e urinarie
Infezione del tratto urinario2
Comune
Disuria
Non comune
Ritenzione urinaria
Non comune
Patologie sistemiche e condizioni relative alla sede di somministrazione
Affaticamento
Non comune
Astenia
Non comune
1
Più frequente per il glicopirronio rispetto al placebo solo nella banca dati a 12 mesi.
2
Osservata più frequentemente per il glicopirronio rispetto al placebo solo negli anziani
>75 anni.
Descrizione di reazioni avverse selezionate. Nella banca dati raggruppata a 6 mesi
la frequenza della secchezza della bocca è stata 2,42% verso 1,1%, dell’insonnia 1,0%
verso 0,8% e della gastroenterite 1,4% verso 0,9%, per Tovanor Breezhaler e placebo rispettivamente. La secchezza della bocca è stata segnalata soprattutto durante le
prime 4 settimane di trattamento, con una durata mediana di quattro settimane nella
maggioranza dei pazienti. Tuttavia nel 40% dei casi i sintomi sono continuati per l’intero
periodo di 6 mesi. Non sono stati segnalati nuovi casi di secchezza della bocca nei mesi
7-12. Segnalazione delle reazioni avverse sospette. La segnalazione delle reazioni
avverse sospette che si verificano dopo l’autorizzazione del medicinale è importante,
in quanto permette un monitoraggio continuo del rapporto beneficio/rischio del medicinale. Agli operatori sanitari è richiesto di segnalare qualsiasi reazione avversa sospetta
tramite l’Agenzia Italiana del Farmaco, sito web: http://www.agenziafarmaco.gov.it/it/
responsabili. 4.9 Sovradosaggio. Dosi elevate di glicopirronio possono provocare la
comparsa di segni e sintomi anticolinergici per i quali può essere indicato un trattamento sintomatico. L’intossicazione acuta a seguito di un’inavvertita ingestione orale delle
capsule di Tovanor Breezhaler è improbabile, a causa della bassa biodisponibilità orale
(5% circa). I livelli plasmatici di picco e l’esposizione totale sistemica dopo somministrazione endovenosa di 150 microgrammi di glicopirronio bromuro (equivalente a 120
microgrammi di glicopirronio) nei volontari sani sono stati 50 volte e 6 volte superiori
dei livelli di picco e dell’esposizione totale allo stato stazionario raggiunti con la dose
raccomandata di Tovanor Breezhaler (44 microgrammi una volta al giorno) e sono stati
ben tollerati.
5. PROPRIETÀ FARMACOLOGICHE
5.1 Proprietà farmacodinamiche. Categoria farmacoterapeutica: farmaci per le
sindromi ostruttive delle vie respiratorie, anticolinergici, codice ATC: R03BB06. Meccanismo d’azione. Tovanor Breezhaler è un antagonista del recettore muscarinico
(anticolinergico) a lunga durata d’azione, per il trattamento della BPCO in monosomministrazione giornaliera nella terapia broncodilatatrice di mantenimento. Le terminazioni
nervose parasimpatiche sono il principale percorso neurale di broncocostrizione delle
vie aeree e il tono colinergico è il componente essenziale reversibile dell’ostruzione del
flusso aereo nella BPCO. Il glicopirronio agisce bloccando l’azione broncocostrittrice
dell’acetilcolina sulle cellule muscolari lisce delle vie aeree, dilatando in questo modo le
vie aeree. Il glicopirronio bromuro è un antagonista ad alta affinità per il recettore muscarinico. Utilizzando studi di legame al radioligando è stata dimostrata una selettività
4 volte maggiore per i recettori umani M3 rispetto ai recettori umani M2. Il glicopirronio
bromuro ha una rapida insorgenza d’azione, come dimostrato dai parametri cinetici di
associazione/dissociazione e dalla rapida insorgenza di azione dopo inalazione negli
studi clinici. La lunga durata d’azione può essere parzialmente attribuita alle prolungate
concentrazioni di sostanza attiva nei polmoni, come risulta dalla prolungata emivita di
eliminazione del glicopirronio dopo inalazione con l’inalatore Tovanor Breezhaler a differenza dell’emivita dopo somministrazione endovenosa (vedere paragrafo 5.2). Effetti
farmacodinamici. Il programma di sviluppo clinico di fase III comprende due studi clinici di fase III: uno studio di 6 mesi controllato con placebo e uno studio di 12 mesi
controllato con placebo e con farmaco attivo (18 microgrammi di tiotropio in aperto una
volta al giorno), entrambi in pazienti con diagnosi clinica di BPCO da moderata a grave.
Effetti sulla funzionalità polmonare. Tovanor Breezhaler 44 microgrammi una volta al
giorno ha portato a un consistente statisticamente significativo miglioramento della funzionalità polmonare (volume espiratorio forzato in un secondo, FEV1, capacità vitale
forzata FVC, e capacità inspiratoria, CI) in numerosi studi clinici. Negli studi di fase III,
gli effetti broncodilatatori si sono manifestati entro 5 minuti dopo la prima dose e sono
stati mantenuti nell’intervallo di dose di 24 ore dalla prima somministrazione. Negli
studi a 6 e 12 mesi non si è verificata alcuna attenuazione nel tempo dell’effetto broncodilatatore. La magnitudine dell’effetto dipende dal grado di reversibilità della limitazione del flusso aereo al basale (esaminata mediante la somministrazione di un broncodilatatore antagonista muscarinico a breve durata d’azione). I pazienti con il livello più
basso di reversibilità al basale (<5%) hanno generalmente mostrato una risposta broncodilatatoria inferiore rispetto ai pazienti con un più alto livello di reversibilità al basale
(≥5%). Dopo 12 settimane (obiettivo primario), rispetto al placebo Tovanor Breezhaler
ha aumentato il trough FEV1 di 72 ml nei pazienti con il livello di reversibilità al basale
più basso (<5%) e di 113 ml nei pazienti con un livello di reversibilità più elevato (≥5%)
(p<0,05 in entrambi i casi). Nello studio a 6 mesi, Tovanor Breezhaler ha aumentato il
FEV1 dopo la prima dose con un miglioramento, rispetto al placebo, di 93 ml entro 5
minuti e di 144 ml entro 15 minuti dalla somministrazione della dose (p<0,001 in entrambi i casi). Nello studio a 12 mesi, i miglioramenti sono stati 87 ml dopo 5 minuti e
143 ml dopo 15 minuti (p<0,001 in entrambi i casi). Nello studio a 12 mesi, Tovanor
Breezhaler ha determinato un miglioramento statisticamente significativo del FEV1
rispetto a tiotropio nelle prime 4 ore dopo somministrazione della dose al giorno 1 e alla
settimana 26, e a valori numericamente superiori di FEV1 rispetto a tiotropio, nelle prime 4 ore dopo somministrazione della dose alla settimana 12 e alla settimana 52. I
valori di FEV1 alla fine dell’intervallo tra le dosi (24 ore dopo la dose) sono risultati simili dopo la somministrazione della prima dose e dopo 1 anno di somministrazione. Alla
settimana 12 (obiettivo primario), Tovanor Breezhaler ha aumentato il trough FEV1 di
108 ml nello studio a 6 mesi e di 97 ml nello studio a 12 mesi rispetto a placebo
(p<0,001 in entrambi i casi). Nello studio a 12 mesi, per tiotropio il miglioramento verso
placebo è stato di 83 ml (p<0,001). Esiti sintomatici. Tovanor Breezhaler somministrato alla dose di 44 microgrammi una volta al giorno riduce in modo statisticamente
significativo la mancanza di respiro come valutata dall’indice di dispnea transitorio
(TDI). In un’analisi raggruppata degli studi principali a 6 e 12 mesi, alla settimana 26
una percentuale superiore statisticamente significativa di pazienti che hanno ricevuto
Tovanor Breezhaler ha risposto con un miglioramento di 1 punto o superiore nel punteggio del TDI rispetto al placebo (58,4% e 46,4% rispettivamente, p<0,001). Questi risultati sono simili a quelli osservati nei pazienti che hanno ricevuto tiotropio, il 53,4% dei
quali ha risposto con un miglioramento di 1 punto o superiore (p=0,009 rispetto al
placebo). Tovanor Breezhaler somministrato una volta al giorno ha anche dimostrato un
effetto statisticamente significativo sulla qualità della vita correlata allo stato di salute
misurata attraverso il St. George’s Respiratory Questionnaire (SGRQ). Un’analisi raggruppata degli studi principali a 6 e 12 mesi ha mostrato che alla settimana 26 una
percentuale superiore statisticamente significativa di pazienti che hanno ricevuto Tovanor Breezhaler ha risposto al SGRQ con un miglioramento di 4 punti o superiore rispetto al placebo (57,8% e 47,6% rispettivamente, p<0,001). Nei pazienti che hanno ricevuto tiotropio, il 61,0% ha risposto al SGRQ con un miglioramento di 4 punti o
superiore (p=0,004 rispetto al placebo). Riduzione delle riacutizzazioni della BPCO.
I dati di riacutizzazione della BPCO sono stati raccolti negli studi pivotali a 6 e 12 mesi.
In entrambi gli studi, la percentuale di pazienti che hanno avuto una riacutizzazione
moderata o grave (definita come tale da richiedere il trattamento con corticosteroidi
sistemici e/o antibiotici o ospedalizzazione) è stata minore. Nello studio a 6 mesi, la
percentuale di pazienti che hanno avuto una riacutizzazione moderata o grave è stata
17,5% per Tovanor Breezhaler e 24,2% per placebo (Hazard ratio: 0,69, p=0,023), e
nello studio a 12 mesi essa è stata 32,8% per Tovanor Breezhaler e 40,2% per placebo
(Hazard ratio: 0,66, p=0,001). In un’analisi raggruppata dei primi 6 mesi di trattamento negli studi a 6 e 12 mesi, rispetto al placebo Tovanor Breezhaler ha prolungato in
modo statisticamente significativo il tempo per la comparsa della prima riacutizzazione
moderata o grave e ha ridotto la frequenza delle riacutizzazioni di BPCO moderate o
gravi (0,53 riacutizzazioni/anno verso 0,77 riacutizzazioni/anno, p<0,001). L’analisi
raggruppata ha anche mostrato che una minore percentuale di pazienti trattati con Tovanor Breezhaler, rispetto a quelli trattati con placebo, ha avuto una riacutizzazione tale
da richiedere ospedalizzazione (1,7% verso 4,42%, p=0,003). Altri effetti. Tovanor
Breezhaler somministrato una volta al giorno ha ridotto in modo statisticamente significativo l’uso di medicinali di soccorso (salbutamolo) di 0,46 spruzzi al giorno (p=0,005)
in 26 settimane e di 0,37 spruzzi al giorno (p=0,039) in 52 settimane, rispetto a placebo negli studi a 6 e 12 mesi, rispettivamente. In uno studio a 3 settimane dove è stata
esaminata la tolleranza all’esercizio mediante cicloergometro (prova da sforzo) con un
carico di lavoro sottomassimale (80%), Tovanor Breezhaler, somministrato al mattino,
ha ridotto l’iperinflazione dinamica e migliorato la durata dell’esercizio, mantenendole
dalla prima somministrazione in poi. Al primo giorno di trattamento la capacità respiratoria sotto sforzo è migliorata di 230 ml e il tempo di resistenza all’esercizio è migliorato di 43 secondi (un aumento del 10%) rispetto al placebo. Dopo tre settimane di trattamento con Tovanor Breezhaler il miglioramento della capacità inspiratoria è stato
simile a quello del primo giorno (200 ml), mentre il tempo di resistenza all’esercizio è
aumentato di 89 secondi (un aumento del 21%) rispetto al placebo. Tovanor Breezhaler
ha dimostrato di diminuire la dispnea e l’esaurimento muscolare a livello degli arti inferiori durante l’esercizio, misurati utilizzando la scala di Borg. Tovanor Breezhaler ha
anche ridotto la dispnea a riposo, misurata attraverso l’indice di dispnea transitorio.
Effetti farmacodinamici secondari. Nei pazienti con BPCO non è stata osservata alcuna
modifica nel ritmo cardiaco medio o nell’intervallo QTc con Tovanor Breezhaler fino a
dosi di 176 microgrammi. In un accurato studio sul QT in 73 volontari sani, l’inalazione
di una singola dose di 352 microgrammi di glicopirronio (8 volte la dose terapeutica)
non ha prolungato l’intervallo QTc e ha leggermente ridotto il battito cardiaco (effetto
massimo –5,9 bpm; effetto medio nelle 24 ore –2,8 bpm) se confrontato al placebo.
L’effetto sul ritmo cardiaco e l’intervallo QTc di 150 microgrammi di glicopirronio bromuro (equivalente a 120 microgrammi di glicopirronio) somministrato per via endovenosa
è stato studiato in individui giovani sani. Sono state raggiunte esposizioni di picco (Cmax)
di circa 50 volte superiori a quelle raggiunte allo stato stazionario dopo l’inalazione di 44
microgrammi di glicopirronio e non si sono verificati tachicardia o prolungamento del
QTc. Si è osservata una lieve riduzione del battito cardiaco (differenza media nelle 24
ore –2 bpm rispetto al placebo), che è un effetto noto della bassa esposizione ai medicinali anticolinergici negli individui giovani sani. Popolazione pediatrica. L’Agenzia
europea dei medicinali ha previsto l’esonero dall’obbligo di presentare i risultati degli
studi con Tovanor Breezhaler in tutti i sottogruppi della popolazione pediatrica per la
BPCO (vedere paragrafo 4.2 per informazioni sull’uso pediatrico). 5.2 Proprietà farmacocinetiche. Assorbimento. Dopo inalazione orale utilizzando l’inalatore Tovanor
Breezhaler, il glicopirronio è stato rapidamente assorbito e ha raggiunto livelli di picco
nel plasma 5 minuti dopo la somministrazione della dose. La biodisponibilità assoluta
del glicopirronio inalato con Tovanor Breezhaler è stata calcolata pari a circa il 45%
della dose erogata. Dopo l’inalazione, circa il 90% dell’esposizione sistemica è dovuta
all’assorbimento polmonare e il 10% è dovuto all’assorbimento gastrointestinale. Nei
pazienti con BPCO, lo stato stazionario farmacocinetico del glicopirronio è stato raggiunto entro una settimana dall’inizio del trattamento. Il picco medio allo stato stazionario e le concentrazioni plasmatiche di valle di glicopirronio per un regime di somministrazione di 44 microgrammi una volta al giorno sono stati rispettivamente 166
picogrammi/ml e 8 picogrammi/ml. L’esposizione al glicopirronio allo stato stazionario
(AUC nell’intervallo di 24 ore tra le dosi) è stata da 1,4 a 1,7 volte superiore a quella
successiva alla prima dose. Distribuzione. Dopo somministrazione endovenosa, il volume di distribuzione del glicopirronio allo stato stazionario è stato di 83 litri e il volume
di distribuzione nella fase terminale di 376 litri. Dopo inalazione, il volume apparente
di distribuzione nella fase terminale è stato di quasi 20 volte superiore e riflette la
più lenta eliminazione dopo inalazione. Il legame in vitro alle proteine plasmatiche
del glicopirronio è stato dal 38% al 41% a concentrazioni da 1 a 10 nanogrammi/ml.
Biotrasformazione. Studi in vitro sul metabolismo hanno mostrato per il glicopirronio
bromuro un percorso metabolico coerente tra gli animali e l’uomo. Sono state osservate l’idrossilazione, con formazione di diversi metaboliti mono- e bi-idrossilati e l’idrolisi
diretta, che conduce alla formazione di un derivato dell’acido carbossilico (M9). In vivo,
M9 si forma dalla frazione ingerita della dose di glicopirronio bromuro inalata. Dopo ripetute inalazioni, sono stati ritrovati nell’urina umana coniugati glucuronidi e/o solfati
del glicopirronio pari a circa il 3% della dose. Alla biotrasformazione ossidativa del glicopirronio contribuiscono molteplici isoenzimi CYP. È poco probabile che l’inibizione o
l’induzione del metabolismo del glicopirronio modifichino in modo consistente l’esposizione sistemica alla sostanza attiva. Studi in vitro sull’inibizione hanno dimostrato che il
glicopirronio bromuro non è in grado di inibire il CYP1A2, CYP2A6, CYP2C8, CYP2C9,
CYP2C19, CYP2D6, CYP2E1 o il CYP3A4/5, i trasportatori di efflusso MDR1, MRP2 o
MXR, e i trasportatori di uptake OCT1 o OCT2. Studi d’induzione enzimatica in vitro non
hanno evidenziato un’induzione clinicamente rilevante del glicopirronio bromuro per gli
isoenzimi del citocromo P450, o per l’UGT1A1 e i trasportatori MDR1 e MRP2. Eliminazione. Dopo somministrazione endovenosa di glicopirronio [3H]-marcato nell’uomo,
l’eliminazione media urinaria di radioattività nelle 48 ore è risultata circa l’85% della
dose. Un ulteriore 5% della dose è stato trovato nella bile. L’eliminazione renale del
farmaco originale è pari a circa il 60-70% della clearance totale del glicopirronio disponibile sistemicamente, mentre i processi di clearance non renale ammontano a circa il
30-40%. La clearance biliare contribuisce alla clearance non renale, ma la maggior
parte della clearance non-renale si pensa sia dovuta al metabolismo. In seguito a inalazione, la clearance renale media del glicopirronio è stata nell’ordine di 17,4 e 24,4 litri/
ora. L’eliminazione tubulare attiva contribuisce all’eliminazione renale del glicopirronio.
Fino al 23% della dose erogata è stata ritrovata nelle urine come farmaco originale. Le
concentrazioni di glicopirronio nel plasma diminuiscono in modo multifasico. L’emivita di
eliminazione terminale media è stata molto più lunga dopo inalazione (da 33 a 57 ore)
rispetto alla somministrazione endovenosa (6,2 ore) e orale (2,8 ore). Il modello di eliminazione suggerisce un assorbimento polmonare prolungato e/o il trasferimento del
glicopirronio nella circolazione sistemica oltre 24 ore dopo l’inalazione. Linearità/Non
linearità. Nei pazienti con BPCO sia l’esposizione sistemica che l’eliminazione urinaria
totale del glicopirronio allo stato stazionario farmacocinetico sono aumentate quasi proporzionalmente nell’intervallo di dose compreso tra 44 e 176 microgrammi. Popolazioni speciali. Un’analisi farmacocinetica di popolazione dei dati nei pazienti con BPCO ha
identificato il peso corporeo e l’età come fattori che contribuiscono alla variabilità di
esposizione sistemica tra i pazienti. Tovanor Breezhaler 44 microgrammi una volta al
giorno può essere usato con sicurezza in tutti i gruppi di età e peso corporeo. Il sesso,
l’abitudine al fumo e il FEV1 al basale non hanno effetto apparente sull’esposizione sistemica. Dopo l’inalazione di glicopirronio bromuro sono state rilevate due importanti
differenze nell’esposizione totale sistemica (AUC) tra soggetti giapponesi e caucasici.
Per altri gruppi etnici o razze sono disponibili dati farmacocinetici insufficienti. Pazienti
con compromissione epatica. Non sono stati condotti studi clinici in pazienti con
compromissione epatica. Il glicopirronio viene eliminato dalla circolazione sistemica
prevalentemente mediante eliminazione renale. Non si ritiene che la compromissione
del metabolismo epatico del glicopirronio possa comportare un aumento rilevante
dell’esposizione sistemica. Pazienti con compromissione renale. La compromissione
renale ha conseguenze sull’esposizione sistemica al glicopirronio bromuro. È stato
osservato un moderato aumento medio dell’esposizione sistemica totale (AUC last) fino a
1,4 volte nei soggetti con compromissione renale lieve e moderata e un aumento fino a
2,2 volte nei soggetti con compromissione renale grave e malattia renale allo stadio
terminale. Nei pazienti con BPCO e compromissione renale lieve e moderata (velocità di
filtrazione glomerulare stimata, eGFR ≥30 ml/min/1,73 m2) Tovanor Breezhaler può
essere usato alla dose raccomandata. Nei pazienti con grave compromissione renale
(eGFR <30 ml/min/1,73 m2), compresi quelli con malattia renale allo stadio terminale
che richiede dialisi, Tovanor Breezhaler deve essere utilizzato solo se il beneficio atteso
supera il potenziale rischio (vedere paragrafo 4.4). 5.3 Dati preclinici di sicurezza.
I dati preclinici non rivelano rischi particolari per l’uomo sulla base di studi convenzionali di safety pharmacology, tossicità a dosi ripetute, genotossicità, potenziale cancerogeno, tossicità della riproduzione e dello sviluppo. Gli effetti attribuibili alle proprietà di
antagonista del recettore muscarinico comprendono un aumento da lieve a moderato
del ritmo cardiaco nei cani, opacità lenticolari nei ratti e modifiche reversibili associate
a ridotta secrezione ghiandolare nei ratti e nei cani. Nei ratti sono state osservate una
lieve irritazione o modifiche di adattamento. Tutti questi effetti si sono verificati a esposizioni che eccedevano sufficientemente quelle anticipate nell’uomo. Dopo somministrazione per inalazione, il glicopirronio non è risultato teratogeno nei ratti o nei conigli.
La fertilità e lo sviluppo pre- e post-natale nei ratti non sono stati influenzati. Il glicopirronio
bromuro e i suoi metaboli non attraversano in modo significativo la barriera placentare di
topi, conigli e cani gravidi. Il glicopirronio bromuro (compresi i suoi metaboliti) è stato escreto nel latte delle ratte in allattamento e ha raggiunto concentrazioni fino a 10 volte superiori nel latte rispetto al sangue della madre. Gli studi di genotossicità non hanno rivelato alcun
potenziale mutageno o clastogenico per il glicopirronio bromuro. Studi di cancerogenicità
condotti in topi transgenici utilizzando la somministrazione orale e nei ratti utilizzando la
somministrazione per inalazione non hanno mostrato evidenza di cancerogenicità a esposizioni sistemiche (AUC) nei topi circa 53 volte superiori e nei ratti circa 75 volte superiori
alla dose massima di 44 microgrammi una volta al giorno raccomandata nell’uomo.
6. INFORMAZIONI FARMACEUTICHE
6.1 Elenco degli eccipienti. Contenuto della capsula. Lattosio monoidrato, Magnesio stearato. 6.2 Incompatibilità. Non pertinente. 6.3 Periodo di validità. 2 anni.
Ciascun inalatore deve essere eliminato dopo 30 giorni di utilizzo. 6.4 Precauzioni
particolari per la conservazione. Non conservare a temperatura superiore ai 25 °C.
Le capsule devono essere sempre conservate nel blister, per proteggerle dall’umidità e
devono essere rimosse dal blister solo immediatamente prima dell’uso. 6.5 Natura e
contenuto del contenitore. Tovanor Breezhaler è un inalatore per dosi singole. Il corpo e il cappuccio dell’inalatore sono costituiti da acrilonitrile-butadiene-stirene, i pulsanti
sono costituiti da metil metacrilato-acrilonitrile-butadiene-stirene. Gli aghi e gli ugelli sono
di acciaio inossidabile. Blister perforato per dosi unitarie di PA/Alu/PVC – Alu. Confezione
singola contenente 6x1, 12x1 o 30x1 capsule rigide e un inalatore. Confezione multipla
contenente 90 (3 astucci da 30x1) capsule rigide e 3 inalatori. Confezione multipla contenente 96 (4 astucci da 24x1) capsule rigide e 4 inalatori. Confezione multipla contenente
150 (25 astucci da 6 x1) capsule rigide e 25 inalatori. È possibile che non tutte le confezioni siano commercializzate. 6.6 Precauzioni particolari per lo smaltimento e la
manipolazione. Deve essere utilizzato l’inalatore fornito con ogni nuova prescrizione.
Ciascun inalatore deve essere eliminato dopo 30 giorni di utilizzo.
Istruzioni per la manipolazione e l’uso.
Come usare l’inalatore
Togliere il cappuccio.
1
Aprire l’inalatore.
Tenere saldamente la base dell’inalatore
e sollevare il boccaglio. In questo modo
si apre l’inalatore.
2
Preparare la capsula.
Separare uno degli alveoli dal resto del blister,
strappando lungo la linea di perforazione. Togliere
la pellicola protettiva dall’alveolo per fare uscire
la capsula. Non spingere la capsula attraverso la
pellicola protettiva.
3
Rimuovere la capsula.
Le capsule devono essere sempre conservate
nel blister e rimosse solo immediatamente prima
dell’uso. Con le mani asciutte, togliere la capsula
dall’alveolo del blister. Non ingerire la capsula.
4
Inserire la capsula.
Inserire la capsula nell’alloggiamento
per la capsula.
Non inserire mai la capsula
direttamente nel boccaglio.
5
Chiudere l’inalatore.
Chiudere l’inalatore fino a sentire un “click”.
6
Forare la capsula.
• Tenere l’inalatore in posizione verticale,
con il boccaglio diretto verso l’alto.
• Forare la capsula premendo con decisione
i due pulsanti laterali l’uno verso l’altro,
contemporaneamente.
Eseguire questa operazione una sola volta.
• Quando la capsula viene forata si deve sentire
un “click”.
7
8
Espirare.
Prima di portare il boccaglio alla bocca
espirare completamente.
Non soffiare nel boccaglio.
9
Inalare il medicinale.
Per inalare profondamente il medicinale
nelle vie aeree:
• tenere l’inalatore come mostrato nella figura.
I pulsanti laterali devono trovarsi a destra
e a sinistra. Non premere i pulsanti laterali;
• portare il boccaglio alla bocca e chiudere
fermamente le labbra attorno al boccaglio;
• inspirare rapidamente ma in modo deciso
e il più profondamente possibile.
Non premere i pulsanti laterali.
10
Trattenere il respiro.
12
Dopo avere inalato il medicinale:
• trattenere il respiro per almeno
5-10 secondi o per un periodo di tempo
sopportabile, rimuovendo l’inalatore
dalla bocca;
• respirare quindi liberamente;
• aprire l’inalatore per verificare se è rimasta
della polvere nella capsula.
Se è rimasta polvere nella capsula:
• chiudere l’inalatore;
• ripetere i punti da 9 a 12. La maggioranza delle
persone è in grado di svuotare la capsula con una o due inalazioni.
Ulteriori informazioni.
Alcune persone possono a volte tossire brevemente dopo avere inalato un medicinale.
Se succede, non ci si deve preoccupare. Fintantoché la capsula è vuota, si è ricevuto
medicinale sufficiente.
Dopo avere preso la dose giornaliera
di Tovanor Breezhaler:
• aprire nuovamente il boccaglio
e rimuovere la capsula capovolgendola
fuori dall’alloggiamento. Gettare la capsula
vuota nei rifiuti domestici;
• chiudere l’inalatore e inserire il cappuccio.
Non conservare le capsule nell’inalatore
Tovanor Breezhaler.
13
7. TITOLARE DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO
Novartis Europharm Limited
Wimblehurst Road
Horsham
West Sussex, RH12 5AB
Regno Unito
8. NUMERO(I) DELL’AUTORIZZAZIONE ALL’IMMISSIONE IN COMMERCIO
EU/1/12/790/001-006
Nota.
Quando si inspira attraverso l’inalatore,
la capsula ruota su se stessa nel suo
alloggiamento e si deve sentire un ronzio.
Mentre il medicinale raggiunge i polmoni
si percepisce un aroma dolce.
Se non si sente il ronzio della capsula.
La capsula può incastrarsi nell’alloggiamento.
Se questo succede:
• aprire l’inalatore e smuovere con cautela
la capsula picchiettando sulla base
dell’inalatore. Non premere i pulsanti laterali;
• inalare nuovamente il medicinale ripetendo
i punti 9 e 10.
ST 101
Titolare AIC
Novartis Europharm Limited
11
9. DATA DELLA PRIMA AUTORIZZAZIONE/RINNOVO DELL’AUTORIZZAZIONE
28/09/2012
10. DATA DI REVISIONE DEL TESTO
12/2013
Classe A – Prezzo 48,26 €*
*Prezzo al netto delle vigenti riduzioni di legge alla data di stampa
Informazioni più dettagliate su questo medicinale sono disponibili
sul sito web della Agenzia europea dei medicinali: http://www.ema.europa.eu
Rappresentante per l’Italia
Depositato presso AIFA in data 10/03/2014 – Cod. 15025484
Rilasciare completamente
i pulsanti laterali.
IV
CONGRESSO
NAZIONALE
8
AIMAR
th
International Conference
on Management & Rehabilitation
of Chronic Respiratory Failure
PESCARA
6-9 maggio 2015
Segreteria organizzativa
Segreteria Scientifica/Provider
srl
Via San Gregorio, 12
20124 Milano
Tel + 39 02 89693750
Fax + 39 0322 091808
Mail: [email protected]
Via Martiri della Libertà, 5
28041 Arona (NO)
Tel + 39 393 9117881 - Fax + 39 0871 222024
Mail: [email protected]
Web: www.aimarnet.it
Cefditoren (pivoxil)
BIBLIOGRAFIA
1. GIASION. Riassunto delle caratteristiche del prodotto
(1)
Depositato presso AIFA in data 08/11/2013
RCP in allegato
Cod. ZGIA164X13D
Potenza e Controllo
Nei pazienti con BPCO
5 minuti per un respiro
lungo un giorno.
D
Depositato
epositato ppresso
resso AAIFA
IFA in
in data
data 10/03/2014
10/03/2014 – Cod.
Cod. 15025484
15025 4 8 4
(1)
Rappresentante per l’Italia
Titolare AIC
Novartis Europharm Limited
1. TTovanor
ovanor® Br
Breezhaler
eezhaler® – Riassunto delle Caratteristiche
Caratteristiche del Prodotto.
Prodotto.